1 / 32

Protein domain BioBricks

Protein domain BioBricks. Perry Tsai June 19, 2006. Goals. (1) Demonstrate the use of protein domains in BioBricks assembly (hDlg experiment) (2) Develop library of BioBrick ’ d protein domains (populate the registry)

kelvin
Download Presentation

Protein domain BioBricks

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Protein domain BioBricks Perry Tsai June 19, 2006

  2. Goals • (1) Demonstrate the use of protein domains in BioBricks assembly (hDlg experiment) • (2) Develop library of BioBrick’d protein domains (populate the registry) • (3) Design and construct a novel protein (for its own sake or for other project) http://www.criduchat.asn.au/criduchat/Images/notebook.JPG

  3. The pCMV mammalian expression vector http://www.stratagene.com/vectors/maps/pdf/pCMV-Tag3A.pdf

  4. The pCMV mammalian expression vector http://www.stratagene.com/vectors/maps/pdf/pCMV-Tag3A.pdf

  5. The pCMV mammalian expression vector http://www.stratagene.com/vectors/maps/pdf/pCMV-Tag3A.pdf

  6. The pCMV mammalian expression vector http://www.stratagene.com/vectors/maps/pdf/pCMV-Tag3A.pdf

  7. The pCMV mammalian expression vector http://www.stratagene.com/vectors/maps/pdf/pCMV-Tag3A.pdf

  8. The pCMV mammalian expression vector http://www.stratagene.com/vectors/maps/pdf/pCMV-Tag3A.pdf

  9. Converting multiple cloning site to BioBricks site BamHI BamHI/XhoI digest sticky ends pCMV-Tag3A vector XhoI

  10. Converting multiple cloning site to BioBricks site BamHI BamHI/XhoI digest sticky ends pCMV-Tag3A vector XhoI + BioBricks linker 5’-GATCCTGAATTCGCGGCCGCTTCTAGAGTACTAGTAGCGGCCGCTGCAGC -3’ 3’- GACTTAAGCGCCGGCGAAGATCTCATGATCATCGCCGGCGACGTCGAGCT -5’ BamHIEcoRINotIXbaI SpeI NotI PstI XhoI

  11. Converting multiple cloning site to BioBricks site BamHI BamHI/XhoI digest sticky ends pCMV-Tag3A vector XhoI + BioBricks linker 5’-GATCCTGAATTCGCGGCCGCTTCTAGAGTACTAGTAGCGGCCGCTGCAGC -3’ 3’- GACTTAAGCGCCGGCGAAGATCTCATGATCATCGCCGGCGACGTCGAGCT -5’ BamHIEcoRINotIXbaI SpeI NotI PstI XhoI ligase BioBricks site pCMV-Tag3A-BB vector pCMV-Tag3A-BB

  12. EcoRI NotIXbaI 5’GTTTCTCCGAATTCGCGGCCGCTTCTAGAG[Part, 5’->3’ sense] Protein domain coding sequence 5’ 3’ 3’ 5’ Converting protein domains to BioBricks [Part, 3’->5’ antisense]-ATGATCATCGCCGGCGACGTCCCTCTTTG 3’ SpeI NotI PstI

  13. EcoRI NotIXbaI 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGAG[Part, 5’->3’ sense] EcoRI NotIXbaI 5’GTTTCTCCGAATTCGCGGCCGCTTCTAGAG[Part, 5’->3’ sense] Protein domain coding sequence 5’ 3’ 3’ 5’ Converting protein domains to BioBricks [Part, 3’->5’ antisense]-ATGATCATCGCCGGCGACGTCCCTCTTTG 3’ SpeI NotI PstI [Part, 3’->5’ antisense]-ATGATCATCGCCGGCGACGTCCCTCTTTG 3’ SpeI NotI PstI PCR Protein domain coding sequence 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGAG 3’ CAAAGAGGCTTAAGCGCCGGCGAAGATCTC EcoRINotIXbaI TACTAGTAGCGGCCGCTGCAGGGAGAAAC 3’ ATGATCATCGCCGGCGACGTCCCTCTTTG 5’ SpeI NotI PstI

  14. EcoRI NotIXbaI 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGAG[Part, 5’->3’ sense] EcoRI NotIXbaI 5’GTTTCTCCGAATTCGCGGCCGCTTCTAGAG[Part, 5’->3’ sense] Protein domain coding sequence 5’ 3’ 3’ 5’ Converting protein domains to BioBricks [Part, 3’->5’ antisense]-ATGATCATCGCCGGCGACGTCCCTCTTTG 3’ SpeI NotI PstI [Part, 3’->5’ antisense]-ATGATCATCGCCGGCGACGTCCCTCTTTG 3’ SpeI NotI PstI PCR Protein domain coding sequence 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGAG 3’ CAAAGAGGCTTAAGCGCCGGCGAAGATCTC EcoRINotIXbaI 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGAG 3’ CAAAGAGGCTTAAGCGCCGGCGAAGATCTC EcoRINotIXbaI TACTAGTAGCGGCCGCTGCAGGGAGAAAC 3’ ATGATCATCGCCGGCGACGTCCCTCTTTG 5’ SpeI NotI PstI XhoI TACTAGTAGCGGCCGCTGCAGGGAGAAAC 3’ ATGATCATCGCCGGCGACGTCCCTCTTTG 5’ SpeI NotI PstI TOPO cloning Protein domain BioBrick TOPO vector Caveat: BioBricks restriction sites need to be removed from the coding sequence via site-directed mutagenesis.

  15. Human homolog of Drosophila Discs-large tumor suppressor • Alternatively spliced isoforms The hDlgprotein McLaughlin M, Hale R, Ellston D, Gaudet S, Lue RA, and Viel A. The distribution and function of alternatively spliced insertions in hDlg. J Biol Chem 2002 Feb 22; 277(8) 6406-12.

  16. Human homolog of Drosophila Discs-large tumor suppressor • Alternatively spliced isoforms • Insertions I2, I3, I4, I5 The hDlgprotein McLaughlin M, Hale R, Ellston D, Gaudet S, Lue RA, and Viel A. The distribution and function of alternatively spliced insertions in hDlg. J Biol Chem 2002 Feb 22; 277(8) 6406-12.

  17. Human homolog of Drosophila Discs-large tumor suppressor • Alternatively spliced isoforms • Insertions I2, I3, I4, I5 • I3 targets to plasma membrane; I2 targets to nucleus The hDlgprotein McLaughlin M, Hale R, Ellston D, Gaudet S, Lue RA, and Viel A. The distribution and function of alternatively spliced insertions in hDlg. J Biol Chem 2002 Feb 22; 277(8) 6406-12.

  18. F11 PCR to create BioBrick parts 1-9 SG25 Mix and match SG35 I2-I5-I4

  19. F11 PCR to create BioBrick parts 1-9 SG25 Mix and match SG35 I2-I5-I4 Assemble into constructs

  20. Progress and agenda • pCMV-Tag3BB vector and BioBrick parts 1-9 have been created, sequenced, and midiprepped. Assemblies have been attempted but not verified. • Next, assemblies need to be completed and verified by sequencing. (3 wks) • Then, constructs can be transfected into human epithelial cells, selected by kanamycin resistance. (2 wks) • Finally, localization of hDlg isoforms will be tested by immunostaining for myc tag. (2 wks)

  21. Pros/Cons • Achievable in 1-2 months by 2-3 people • An observable proof of principle • The principle has already been proven. (Silver lab) • Not creative • Not iGEM-y http://www.physlink.com/estore/cart/item_images/780_xl.jpg

  22. Protein domain BioBricks library • Develop a BioBricks library of protein domains within the Registry • Mix and match protein domains • Model alternatively spliced proteins, like in hDlg experiment • Add, remove, or replace domains for altered functionality • Fuse domains together into chimeric proteins • Design new proteins from characterized domains http://parts.mit.edu/registry/index.php/Image:Registry-head-c2g.png

  23. Types of domains • Receptor (iron, aspartate) • Kinase (tyrosine, serine) • Transmembrane (OmpX) • Localization (nuclear, membrane) • Targeting (intercell) • DNA binding (repressor) http://olenka.med.virginia.edu/mcsg/images/structures/2AU5x500r.jpg

  24. Sources of domains • Genomes (E. coli, human, yeast) • cDNA, clone libraries • Synthesis • Mutation • Evolution http://olenka.med.virginia.edu/mcsg/images/structures/2AU5x500r.jpg

  25. Agenda • Find out what domains Silver lab has BioBrick’d and what may be added to the Registry. • Research other interesting domains, design primers, order primers, DNA sources, and plasmids. (2 wks) • BioBrick parts from chosen protein domains, add BioBricks sites to plasmids if necessary, clone into plasmids. . (3 wks) • Modify parts as needed (remove restriction sites, mutations). (1 wk) • Verify parts by sequencing. (1 wk)

  26. Pros/Cons • Flexible timeline and goals • Estimated goal of 10-15 parts in 2 months by 3-4 people • Independent chances at success and failure • Potential to plan for more parts if ahead of schedule • Important for future iGEM teams, future protein domain research • Silver lab experience • Not terribly exciting • Not creative, except choice/modification of parts http://www.physlink.com/estore/cart/item_images/780_xl.jpg

  27. Designing/constructing a novel protein • Use BioBrick’d protein domains to build a new protein • Can be any desired protein, or a protein useful for another project http://www.cygnus-x1.net/links/lcars/blueprints/star-trek-the-motion-picture-sheet-4.jpg

  28. Chimeric protein examples • LamB secretion signal + mature bovine somatotropin • Klein BK, Hill SR, Devine CS, Rowold E, Smith CE, Galosy S, and Olins PO. Secretion of active bovine somatotropin in Escherichia coli. Biotechnology (N Y) 1991 Sep; 9(9) 869-72. • Aspartate chemoreceptor + EnvZ activator of OmpC transcription • Utsumi R, Brissette RE, Rampersaud A, Forst SA, Oosawa K, and Inouye M. Activation of bacterial porin gene expression by a chimeric signal transducer in response to aspartate. Science 1989 Sep 15; 245(4923) 1246-9. • Aspartate chemoreceptor + human insulin receptor kinase • Moe GR, Bollag GE, and Koshland DE Jr. Transmembrane signaling by a chimera of the Escherichia coli aspartate receptor and the human insulin receptor. Proc Natl Acad Sci U S A 1989 Aug; 86(15) 5683-7. • Iron receptor + beta-galactosidase • Coulton JW, Mason P, Cameron DR, Carmel G, Jean R, and Rode HN. Protein fusions of beta-galactosidase to the ferrichrome-iron receptor of Escherichia coli K-12. J Bacteriol 1986 Jan; 165(1) 181-92. • Maltose-binding protein + SH2 tyrosine kinase substrate • Sierke SL and Koland JG. SH2 domain proteins as high-affinity receptor tyrosine kinase substrates. http://www.planetadnd.com/interactive_books/chimera.gif

  29. Agenda • Design a novel protein, and research necessary domains. Design primers. Order DNA source, primer, plasmid. (1 wk) • BioBrick domains, add BioBrick site to plasmid if necessary, clone into plasmid. (2 wks) • Modify parts as needed (remove restriction sites) (1 wk) • Verify parts by sequencing, while beginning assembly. (1 wk) • Complete assembly, and verify by sequencing. (2 wks) • Test functionality of construct. (1 wk)

  30. Pros/Cons • Creative exercise • Applicable and useful to many potential projects • Difficult to ensure success with a novel protein • Protein domains may not be so modular • Tighter timeline because of BioBricking + assembly. http://www.physlink.com/estore/cart/item_images/780_xl.jpg

  31. Final thoughts • 3 projects: (1) hDlg, (2) library, (3) novel protein • Interestingness? 1 < 2 < 3 • 1 is “easily” achievable • 2 & 3 have overlapping agendas; feasible with 4-5 people working over 2 months. • 2 & 3 require further research • 1 & 2 are independent projects, while 3 may depend on 2, and another project may depend on 3

More Related