Jim Thompson
Sponsored Links
This presentation is the property of its rightful owner.
1 / 37

Ron Woodruff PowerPoint PPT Presentation


  • 67 Views
  • Uploaded on
  • Presentation posted in: General

Jim Thompson. Ron Woodruff. Clay Hallman. These creatures are hard to photograph! (Jim holds the camera, and Clay is adept at avoiding it.). Jim is a David Ross Boyd Professor of Biology at OU, and Clay is a Research Associate.

Download Presentation

Ron Woodruff

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Jim Thompson

Ron Woodruff

Clay Hallman


These creatures are hard to photograph! (Jim holds the camera, and Clay is adept at avoiding it.)

Jim is a David Ross Boyd Professor of Biology at OU, and Clay is a Research Associate.

Jim and Ron have taught this course for about 24 years, and this is Clay’s 10th year as the Teaching Assistant.


Ron is a Distinguished Research Professor at Bowling Green State University in Ohio.

(Ron is simply able to focus on other things and, thus, ignore the camera.)


The University of Oklahoma Biological Station is located on the quiet shore of Lake Texoma, at one time the largest man-made reservoir in the world.


But then, at other times, it was not quite so quiet!


We worked in two adjacent rooms on the first floor of the classroom building.

The Station has wonderful resources for small, intensive classes like ours, as well as support for year-round graduate student and faculty researchers.


Our activities were split between a lecture/writing room and a separate lab, where chemicals and other potential hazards could be safety used and monitored.


They also have good food!

That is good, because there is not much else around for dozens of miles.


Molecular Techniques for Field Biology

Brad Snider

Danielle Vinnedge

Rachel Flanagan

Robert Byrd

Danielle Strawn

Jennie Lee


Molecular Techniques for Field Biology

Taylor Paziuk

Adam Richardson

Barun Bouvia

Zain Hyder

James Pembrook

John Logan


Although we had four “Lab Groups”,in practice everyone worked together.

Green:

Red:

Robert Byrd

Brad Snider

Danielle Vinnedge

Rachel

Flanagan

John Logan

James Pembrook

Brown:

Blue:

Barun BouviaZain Hyder

Danielle Strawn

Jennie Lee

Taylor Paziuk

Adam Richardson

FRONT


Barun Bouvia

Zain Hyder

Danielle Strawn


Robert Byrd

Brad Snider

Danielle Vinnedge


Rachel Flanagan

John Logan

James Pembrook


Jennie Lee

Taylor Paziuk

Adam Richardson


Who would have thought spots could be so much fun?


Seining will probably not become a popular spectator sport.


Is it still called “field” work when it is wet?


Such a big lake

… such little nets.

Eventually, we caught one minnow. (We believe in quality, not quantity – although quantity would not have been turned away)!


The whole class prepared successful protein electrophoresis plates from different parts of this now-famous minnow.


It’s all in the wrists!


A nice combination of individual and team work.


Back safely from another field trip – (to the lab down the road)


At the Station we are surrounded by biology.


Our data were put into the appropriate theoretical framework.

(Our jokes, however, were in a class of their own.)


Preparing for a guest lecture by Dr. Philip Morton.

He engaged us with a research project that involved us in generating hypotheses and applying our new knowledge.


Using molecular genetic databases … there is a world of data out there!


Results from our BarCoding of tissue samples by PCR

Sample 5

>MT1-5_HCO

TATCTTGGTATAAATAGGGTCTCCTCCTCCAGCAGGATCAAAGAATGATGTATTAATATTTCGGTCTGTTAAGAGTATTGTGATTGCTCCGGCGAGTACGGGTAGAGAAA

GAAGTAATAATAAGGCAGTTAAAGCTACTGATCAGACAAATAGAGGCATTCGATCAAAAGTTATTCCTGTAGAACGCATATTAATAACAGTTGTAATAAAATTTACAGCCC

CGAGGATTGATGAGATTCCTGCAAGGTGAAGCCTAAAAATAGCTAAATCTACAGAAGCCCCTCTATGAGCGATATTAGAGGATAATGGCGGGTAAACAGTTCAACCTGT

CCCGGCCCCTCTTTCTACAAGGCTTCTCATTAAAAGAAGAGTTAGGGAAGGGGGTAGTAATCAAAATCTTATATTATTTATTCGAGGGAATGCTATATCAGGGGCACCCA

ATATAAGTGGTACAAGCCAATTTCCAAACCCTCCAATTATAATAGGTATTACTATAAAGAAAATTATTACAAATGCATGAGCAGTTACAATAACATTATAAATTTGGTCGTCT

CCGATTAATGTTCCCGGATTTCCAAGTTCAGCTCGAATAAGTAATCTTAATGAGGTTCCAACTATACCTGCTCATCTTCCAAAGAGAAAGTATAAGGTTCCAATATCTTTAT

BLAST result: Phyllophaga crassissima

Cytochrome Oxidase I (COI) Sequences

BLAST result: Chironomus entis

BLAST result: Coccinella septempunctata

BLAST result: Drosophila suzukii

BLAST result: Lucilia coeruleiviridis

BLAST result: Leptoglossus occidentalis


BLAST result: Melanoplus

BLAST results: Solenopsis invicta

BLAST result: Larinioides cornutus

BLAST result: Solenopsis invicta

BLAST result: Estigmene acrea

BLAST result: Phidippus audax


preparing a research talk on a paper using various molecular techniques – our “final exam”


Molecular Techniques for Field Biology – 2013


  • Login