Faithfulness and infidelity
Download
1 / 49

Faithfulness and Infidelity: - PowerPoint PPT Presentation


  • 108 Views
  • Uploaded on

Faithfulness and Infidelity:. Homologous Recombination and DNA Double-Strand Break Repair in Mammalian Cells. Ongoing projects. Fidelity of recombination and DNA double-strand break repair in mammalian genomes “At-risk” DNA motifs in mammalian chromosomes

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Faithfulness and Infidelity:' - kami


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Faithfulness and infidelity

Faithfulness and Infidelity:

Homologous Recombination and

DNA Double-Strand Break Repair in Mammalian Cells


Ongoing projects
Ongoing projects

  • Fidelity of recombination and DNA double-strand break repair in mammalian genomes

  • “At-risk” DNA motifs in mammalian chromosomes

  • Methods for making targeted alterations to a mammalian genome

  • Influence of gravitational force on recombination and repair

  • Effect of chemotherapy on genome stability


Homologous Recombination:

The exchange of information (nucleotides) between similar DNA sequences.


Recombination is involved in
Recombination is involved in:

  • Genome maintenance -- DNA repair, replication rescue

  • Generation of genetic diversity in meiosis

  • Development of disease (cancer, hypercholesterolemia, age-related disorders)

  • Gene targeting


noncrossover

(gene conversion)

crossover

Homologous Recombination, Holliday Model


Homologous Recombination,

Double-Strand Break Repair

noncrossover

noncrossover

crossover


Problem:

How does a cell balance the benefits of efficient DNA recombination & repair against the risk of deleterious rearrangements?


How similar must two sequences be

in order to undergo recombination in

mammalian chromosomes?


Recombination

Rate

~ 10-6

<10-9

homologous

homeologous


What we have learned
What we have learned:

  • Recombination in mammalian cells is very sensitive to small degrees of sequence divergence -- a single mismatch matters

  • Not all mismatches inhibit recombination to the same degree (C-C or G-G mispairs strongly inhibit recombination)

  • The minimal amount of contiguous homology needed for efficient recombination is >134 bp


Question
Question:

What cellular players are responsible for the exquisite sensitivity of recombination to mismatches ?

Likely candidates --

DNA mismatch repair proteins


Some known functions of eukaryotic mmr proteins

_________________________

Some known functions of eukaryotic MMR proteins

  • Mutation avoidance (spell-checking)

  • Antirecombination

    • Prevention of homeologous recombination (in yeast and bacteria)

  • Implicated in DSB repair in yeast

  • Meiosis

    • Promotion of meiotic crossovers

    • Proper segregation of homologs

  • Cell signaling of certain types of DNA damage

    • Apoptosis/cell cycle checkpoints

  • Mutations in certain MMR genes lead to hereditary nonpolyposis colorectal cancer (HNPCC)


Eukaryotic muts and mutl homologs

MLH1

PMS1

MLH2

MLH3

MLH1

PMS2

PMS1

MLH3

Eukaryotic MutS and MutL homologs:

MutS homologs

S. cerevisae

Mammalian

MSH1

MSH2

MSH3

MSH4

MSH5

MSH6

MSH2

MSH3

MSH4

MSH5

MSH6

MutL homologs


Substrates to measure homologous and homeologous recombination:

Homologous donor:

tk1

hyg

tk1

neo

H

H

B

B

Homeologous donor:

tk2

hyg

tk1

neo

H

H

B

B


Homologous and Homeologous Recombination Frequencies recombination:

in Mlh1-/- Mouse Embryonic Fibroblasts


Homologous and Homeologous Recombination Frequencies recombination:

in Msh2-/- Chinese Hamster Ovary Cells


neo recombination:

B

3.9 kb

3.9 kb

neo

Screening for gene conversions versus crossovers:

Gene conversion:

tk1

hyg

tk1

B

H

B

4.5 kb

Crossover (“pop-out”):

tk1

B

B


Representative Southern Blot recombination:

Analysis of Recombinants

(BamHI digests)

gene conversion

crossover


Conclusion: recombination:

A single defect in MMR gene Msh2 or Mlh1 does not lift the barrier to spontaneous homeologous recombination in a mammalian genome


What about a possible role recombination:

for MMR proteins in

double-strand break repair?


Accurate Double-Strand Break Repair recombination:

via Homologous recombination

noncrossover

crossover


Error-prone recombination:Nonhomologous End-Joining (NHEJ)



DSB induction recombination:

neo

t

k

Repair by NHEJ

t

Functional

fusion gene

(G418R)

neo

k

neo

I-SceI

Nonfunctional

fusion gene

(G418S )

neo

tk



Sequences of Mlh1 recombination:+/+ repair junctions:

Sequence 5’ to junction

Sequence 3’ to junction

Del size (L/R)

No. clones


Sequences of mlh1 repair junctions
Sequences of Mlh1 recombination:-/- repair junctions

Sequence 5’ to junction

Sequence 3’ to junction

Del size (L/R)

No. clones


51-60 recombination:

1-10

11-20

21-30

31-40

41-50

61-70

71-80

81-90

91-100

>100

Deletion Sizes Associated with NHEJ

100

Mlh1-/-

Median

Deletion = 1 bp

80

Frequency of NHEJ events

60

Mlh1+/+

Median

Deletion = 46 bp

40

20

0

Number of base pairs deleted


Mlh1-/- recombination:

Mlh1 +/+

NHEJ Junctions in MMR Proficient Cells

Display a Greater Usage of Terminal Homology


Conclusions
Conclusions recombination:

  • No evidence that Mlh1 status affects overall efficiency of NHEJ

  • NHEJ repair junctions in Mlh1+/+ cells display larger deletions and more terminal microhomology relative to repair junctions in Mlh1-/- cells

  • Mlh1+/+ cells display a greater frequency of complex rearrangements in association with DSB repair than do Mlh1-/- cells. (Could this be related to the stable karyotypes of HNPCC tumors?)


Conclusions continued
Conclusions, continued recombination:

  • Both Mlh1+/+ and Mlh1-/- cells are proficient at precise ligation

  • Msh2+/+ fibroblasts display more microhomology at NHEJ repair junctions than do Msh2-/- fibroblasts


MMR recombination:

Model for Inhibition of NHEJ by MMR

MMR binding to mismatched bases in

overlapped ends

Collapse of joined intermediate with

concomitant end trimming or unwinding

Joining of intermediates

with suitable homology

Gap filling and ligation


Does MMR play a role in recombination:

accurate recombinational repair

of a DSB?


Substrates to measure DSB-induced homologous and homeologous recombination:

Homologous donor:

tk1

hyg

tk1

neo

H

H

B

B

I-SceI

Homeologous donor:

tk2

hyg

tk1

neo

H

H

B

B

I-SceI


Spontaneous and DSB-induced Homologous Recombination recombination:

Frequencies in Msh2+/+ and Msh2-/-

Chinese Hamster Ovary Cells


Conclusions1
Conclusions: recombination:

  • A DSB can induce high levels of HR in Msh2+/+ and Msh2-/- CHO cells

  • Gene conversions predominate among spontaneous or DSB-induced HR events in MMR proficient or deficient cells

  • Gene conversion tracts are longer in Msh2-/- cells than in Msh2+/+ cells

  • To our knowledge, our work provides the first unequivocal demonstration of accurate recombination as a major DSB repair pathway in a mammalian cell


Future work
Future work recombination:

• Investigate the effects of additional MMR mutations or combinations of MMR mutations in the control of recombination fidelity.

  • Investigate the role of RecQ family helicases (BLM and WRN) in recombination fidelity and in DSB repair.

    • Determine if a DSB can by itself provoke homeologous recombination.


Future work continued
Future work, continued recombination:

• Explore how various genes associated with genome maintenance impact DSB repair pathways in mammalian chromosomes. (Some genes of interest-- p53, BLM, WRN, Ku70/80, BRCA1&2)

Useful approaches– use mutant (or K0’d) human and rodent cell lines, and RNAi


Acknowledgments recombination:

Laura Bannister

Yunfu Lin

Tamas Lukacsovich

Jason Smith


from recombination:Christmann et al. (2003) Toxicology 193:3-34


Screen for homologous recombination: recombination:

Donor: HSV-tk1

Recipient: HSV-tk1

I-SceI

Donor sequence:

catgtcgggggggaggctgggagtt----------------------cacatgccccgccc

Recipient sequence:

catatcgggggggaggctgggagctTAGGGATAACAGGGTAATAGCTcacatgccccgccc

AluI

AluI

Recombinant sequence:

catgtcgggggggaggctgggagttcacatgccccgccc


Screen for loss of alui sites
Screen recombination:for loss of AluI sites:


HR, revisited recombination:

This end of newly

synthsized DNA

can be re-joined

to other side of

DSB by NHEJ

from Schofield and Hsieh (2003) Annu. Rev. Microbiol. 57: 579-608


I- recombination:Sce IXba II-Sce I

CATCCCTATTGTCCCATTAGATCTATCCCTATTGTCCCATTAGTCGA

CAGGGTAAT

TATTGTCCCATTA

Assay for high-fidelity DSB repair

(precise ligation)

____________

GTAGGGATAACAGGGTAATCTAGATAGGGATAACAGGGTAATCAGCT

(+47 bp)

CAGGGTAATCTAGATAGGGATAA

(-23 bp)

DSB induction at both I-Sce I sites

TAGGGATAA

ATCCC

precise ligation of DNA termini

I-Sce I

GTAGGGATAACAGGGTAATCAGCT (+24 bp)


Ways in Which MMR May Block recombination:

Homeologous Recombination


ad