Characterization of maize t rans g ene r eactivated (tgr) mutants.

1. Rmr1, Rmr2, Mop1 other proteins dsRNA siRNAs No expression, GREEN plant CH3 CH3 CH3 CH3 CH3 B1 coding region 35S CaMV promoter / adh1 intron A. Epigenetically silent BTG in wild type plant. Characterization of maize transgene reactivated (tgr) mutants. Result 1. DNA methylation is reduced in tgr6, tgr9, and tgr11. Rmr1, or Rmr2, or Mop1 NOT PRESENT Affects of Bisulfite Conversion Expression, PURPLE plant (some methylation persists in some homozygous mutants) Unconverted DNA strand CTATGACGTTATACGTAA Unmethylated Methylated CTATGATGTTATACGTAA Converted DNA strand CH3 Potential Methylation Locations B1 coding region 35S CaMV promoter / adh1 intron GACGTCTTTCATTAAAGAACAGG Example sequence from region of interest B. Epigenetically reactivated BTG in homozygous mutant plant. Key: CG CHH CHG Introduction: In living organisms, physical characteristics are often visual manifestations of the activity of molecules in the cell. These molecules are created through gene expression, where genetic information is transcribed and translated into proteins that create other molecules, modify cellular structure, or catalyze reactions. In some cases, the rate or efficiency of gene expression is associated with specific characteristics of the DNA, such as the addition of methyl groups to cytosines in the DNA, or modifications of proteins associated with the DNA. When these types of characteristics influence the rate of gene expression, epigenetic gene regulation is occuring. Epigenetic gene regulation is crucial for normal development in a wide range of organisms, including most plants and animals. When epigenetic gene regulation is disrupted, it can lead to developmental abnormalities, and various diseases or disorders. The b1 genomic transgene (BTG) is subjected to epigenetic gene regulation in wild type (non-mutant) maize plants (Figure 1). The maize tgr mutants are unable to maintain epigenetic regulation of BTG, meaning that these mutants are defective in an epigenetic gene regulatory pathway. These mutants are useful in studying the mechanisms of epigenetic gene regulation. Objective: To characterize the maize tgrmutants and understand the function of wild type TGR proteins in epigenetic gene regulation. Figure 2. DNA methylation was analyzed using the bisulfite DNA conversion and sequencing technique (A), and compared between non mutant (green) plants exhibiting BTG silencing, and mutant (purple) plants where epigenetic silencing had been disrupted (B). Result 2. tgr2 is likely a mutation in a novel gene. Figure 3. Some proteins required for epigenetic gene regulation have already been identified in maize, and there are available mutants that are unable to produce these proteins. Because mutagenesis is random, it is not known which genes are disrupted in the tgr mutants. Molecular linkage analysis was used to determine if the tgr2 phenotype results from a disruption in a gene that is already known to function in epigenetic gene regulation in maize. Based on this analysis, Tgr2 appears to be a novel gene. Tgr9 also appears to be a novel gene (data not shown). Figure 1. Epigenetic regulation of b1 genomic transgene (BTG). BTG has been introduced into the maize genome and is stably integrated into one of the plant’s chromosomes. In wild type plants (A), epigenetic silencing has occurred, and the transgene is not expressed. In some mutants (B), a protein required for epigenetic silencing is lacking, and epigenetic silencing cannot occur. As a result, BTG is transcribed, and a functional B1 protein is created. This protein activates other proteins, leading to purple pigmentation in the plants. • Conclusions and future research directions: • DNA methylation is reduced in a subset of the mutants, suggesting that in wild type plants, the encoded proteins function in a DNA methylation related pathway. • Tgr2 and Tgr9 are likely to be currently undiscovered genes that encode proteins required for epigenetic gene regulation. This suggests that these two mutants will be exciting candidates for future studies. • Ongoing research is focused on analyzing other aspects of the mutant phenotypes, and determining which genes are mutated in each mutant. Acknowledgements: Data, figures, and photos for this poster were contributed by Shannon Mills and Thelma Madzima, both members of the McGinnis laboratory. Contact information: Karen M. McGinnis Department of Biological Science Florida State University, King Building 850-645-8814 mcginnis@bio.fsu.edu