Biotechnology
Download
1 / 33

Biotechnology - PowerPoint PPT Presentation


  • 62 Views
  • Uploaded on

Biotechnology. DNA Technology. What is Biotech. Biobyte – what is biotech. Restriction enzymes. Bacteria fight invading viruses with Restriction Enzymes. Degrade phage DNA by cleaving (cutting) it into fragments. .

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Biotechnology' - jenny


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Biotechnology

Biotechnology

DNA Technology


What is biotech
What is Biotech

Biobyte – what is biotech


Restriction enzymes
Restriction enzymes

Bacteria fight invading viruses with Restriction Enzymes.

Degrade phage DNA by cleaving (cutting) it into fragments.


Why doesn’t a restriction enzyme cut the DNA of the bacterial cell that makes it?

Methylation protects the bacteria’s own DNA from being cleaved.


Example
Example bacterial cell that makes it?

For example, the enzyme EcoRI cuts DNA only where it encounters the following paired sequence in the DNA double helix:


You try it
You try it! bacterial cell that makes it?

TCGAATTCTAGGCTAACCGGAGASTTCACCGTACGAATTCCTTCAGCAATTCAGACGTA

(video clip – human physiology restriction enzymes)


Restriction enzyme flash bacterial cell that makes it?


Gel electrophoresis
Gel Electrophoresis bacterial cell that makes it?

When DNA is treated with restriction enzymes, the DNA is cut into fragments of various sizes.

These fragments can be separated in a gel on the bases on their electric charge and size.


Gel electrophoresis1
Gel Electrophoresis bacterial cell that makes it?

Flash video


Dna fingerprinting
DNA fingerprinting bacterial cell that makes it?

  • DNA-based technique for identifying individuals.

  • Uses restriction analysis and electrophoresis.


Crime scene and dna fingerprinting
Crime Scene and DNA fingerprinting bacterial cell that makes it?


Dna fingerprinting1
DNA Fingerprinting bacterial cell that makes it?

DNA fingerprinting methods require at least

1 µg of DNA, or the DNA content of about 100,000 human cells.


Polymerase chain reaction pcr
polymerase chain reaction (PCR) bacterial cell that makes it?

Can multiply (“amplify”) the DNA of interest from even a single cell, producing in a few hours the necessary

1 µg for restriction digestion and electrophoresis.


PCR bacterial cell that makes it?

1) Double-stranded fragments of DNA are separated into single strands by heating (denatured).


PCR bacterial cell that makes it?

2) ADD:

a) A short primer

b) along with the Bases (A,C,T,G)

c) DNA polymerase to catalyze the production of complementary new strands. (video polymerase chain reaction animated)


Dna barcode
DNA Barcode bacterial cell that makes it?


Dna barcode1
DNA BARCODE bacterial cell that makes it?

Identify each species with a “DNA barcode”

He chose is the cytochromeoxidase gene.

Mutates readily, there should be many differences between species.

Present in most cells

Reasonable in size (650-750 base pairs)


Why dna barcode
Why DNA barcode? bacterial cell that makes it?

advance biological research on evolution

to track species diversity

help identify new species

detect undesirable microbes or bioterrorism agents


Make your own transgenic plant
Make your own transgenic plant bacterial cell that makes it?


ad