biotechnology
Download
Skip this Video
Download Presentation
Biotechnology

Loading in 2 Seconds...

play fullscreen
1 / 33

Biotechnology - PowerPoint PPT Presentation


  • 62 Views
  • Uploaded on

Biotechnology. DNA Technology. What is Biotech. Biobyte – what is biotech. Restriction enzymes. Bacteria fight invading viruses with Restriction Enzymes. Degrade phage DNA by cleaving (cutting) it into fragments. .

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Biotechnology' - jenny


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
biotechnology

Biotechnology

DNA Technology

what is biotech
What is Biotech

Biobyte – what is biotech

restriction enzymes
Restriction enzymes

Bacteria fight invading viruses with Restriction Enzymes.

Degrade phage DNA by cleaving (cutting) it into fragments.

slide13

Why doesn’t a restriction enzyme cut the DNA of the bacterial cell that makes it?

Methylation protects the bacteria’s own DNA from being cleaved.

example
Example

For example, the enzyme EcoRI cuts DNA only where it encounters the following paired sequence in the DNA double helix:

you try it
You try it!

TCGAATTCTAGGCTAACCGGAGASTTCACCGTACGAATTCCTTCAGCAATTCAGACGTA

(video clip – human physiology restriction enzymes)

gel electrophoresis
Gel Electrophoresis

When DNA is treated with restriction enzymes, the DNA is cut into fragments of various sizes.

These fragments can be separated in a gel on the bases on their electric charge and size.

dna fingerprinting
DNA fingerprinting
  • DNA-based technique for identifying individuals.
  • Uses restriction analysis and electrophoresis.
dna fingerprinting1
DNA Fingerprinting

DNA fingerprinting methods require at least

1 µg of DNA, or the DNA content of about 100,000 human cells.

polymerase chain reaction pcr
polymerase chain reaction (PCR)

Can multiply (“amplify”) the DNA of interest from even a single cell, producing in a few hours the necessary

1 µg for restriction digestion and electrophoresis.

slide26
PCR

1) Double-stranded fragments of DNA are separated into single strands by heating (denatured).

slide27
PCR

2) ADD:

a) A short primer

b) along with the Bases (A,C,T,G)

c) DNA polymerase to catalyze the production of complementary new strands. (video polymerase chain reaction animated)

dna barcode1
DNA BARCODE

Identify each species with a “DNA barcode”

He chose is the cytochromeoxidase gene.

Mutates readily, there should be many differences between species.

Present in most cells

Reasonable in size (650-750 base pairs)

why dna barcode
Why DNA barcode?

advance biological research on evolution

to track species diversity

help identify new species

detect undesirable microbes or bioterrorism agents

ad