Kwa sey phd mph yingbo ma ms nannie song mph
Download
1 / 29

Kwa Sey, PhD, MPH Yingbo Ma, MS Nannie Song, MPH - PowerPoint PPT Presentation


  • 100 Views
  • Uploaded on

Using Phylogenetic Analysis to Identify HIV Transmission Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010. Kwa Sey, PhD, MPH Yingbo Ma, MS Nannie Song, MPH . BACKGROUND.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Kwa Sey, PhD, MPH Yingbo Ma, MS Nannie Song, MPH ' - jaimie


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Kwa sey phd mph yingbo ma ms nannie song mph

Using Phylogenetic Analysis to Identify HIV Transmission Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

Kwa Sey, PhD, MPH

Yingbo Ma, MS

Nannie Song, MPH


BACKGROUND Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

  • Los Angeles County ranks second in nation only to New York City for highest number of living AIDS cases

  • Between 1982-2010, cumulative total of 75,114 persons with HIV/AIDS reported in LAC

  • Major transmission channels indicated by self-report:

    • male to male sex (79%)

    • heterosexual sex (12%)

    • injection drug use (9%)

      *2010 Annual HIV Surveillance Report, January 2011:1-32, HIV Epidemiology Program., LAC-DPH


Background
BACKGROUND Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

  • New techniques, such as phylogenetic analysis of HIV sequence data, can provide biological evidence for HIV transmission channels and signal emerging trends


What is phylogenetic analysis
What is Phylogenetic analysis? Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

  • The means of inferring evolutionary relationships through molecular sequencing data. The evolutionary history is usually depicted as a branching, treelike diagram


What is phylogenetic analysis1
What is Phylogenetic analysis? Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

  • Phylogenetic relationships used to infer epidemiological links among individuals, such as persons infected with HIV

  • Phylogenetic analysis used to understand patterns of HIV transmission among young black MSM in Mississippi.

  • (CDC, 2011)


Hiv sequencing genotyping
HIV Sequencing/Genotyping Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

Schematic of HIV-1 particle

(in cross-section)

Viral genome

HIV GENOTYPING RESULT

ACTCTTTGGCAACGACCCCTTGTCACAATAAAGATAGGGGGGCAACAAAAGGAAGCTCTATTAG…

Fragment of the pol region for VARHS genotyping: 1020 nucleotides


Guidelines for genotyping
Guidelines for genotyping Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

  • Genotyping now recommended for all newly diagnosed HIV infected individuals, presenting us with increasingly comprehensive HIV sequence data and opportunity to investigate population level HIV transmission patterns


Objectives
OBJECTIVES Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

  • Objective of this analysis to use phylogenetic analyses to characterize HIV transmission channels in Los Angeles County


Methods
METHODS Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

  • Obtained HIV genomic sequences from VARHS (Variant Atypical and Resistant HIV Surveillance System)

  • VARHS

    • extension of the existing national population-based HIV/AIDS case surveillance system

    • coordinated and funded by CDC

  • Since 2006, as part of VARHS, the LAC DHSP HIV Epidemiology has obtained HIV pol region genetic sequences from county residents newly diagnosed with HIV


Methods1
METHODS Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

For inclusion in this analysis, cases had to be:

  • LAC residents

  • Newly diagnosed with HIV

  • Reported to eHARS following a confidential HIV test

  • Antiretroviral naïve

  • Have available genomic sequence (pol region) data from specimen collected within 3 months of diagnosis

  • .


Methods2
METHODS Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

  • Obtained genetic sequencing data for 1,407 (29%) out of 4933 LAC HIV cases diagnosed between 2009 and 2010

  • HIV sequence data merged with demographic and risk behavior data from the Enhanced HIV/AIDS Reporting System (eHARS)


Methods3
METHODS Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

  • Neighbor joining phylogenetic analysis performed on pol sequence spanning protease and reverse transcriptase

  • Nucleotide distances calculated using Kimura's two-parameter method in MEGA5, with 1000 bootstrap replications

  • Transmission clusters defined as sequences that had:

    • common node of bootstrap values greater than 95% and

    • average genetic distance lower than 0.015 nucleotide substitutions per site


Results
RESULTS Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010


Gender
Gender Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010


Age at hiv diagnosis
Age at HIV diagnosis Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

Average age: 33 years.


Race ethnicity
Race/Ethnicity Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010


Country of origin
Country of Origin Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010


MSM Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010Cluster- 56%

MSM/IDU Cluster- 6%

MSM/HET Cluster- 6%

IDU/HET Cluster- 6%

Identified 16 clusters, representing 49 cases.

Each cluster comprised of 3-4 cases.

Clusters categorized into 4 cluster types.

All subtype B.


Msm transmission channel

MSM Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010,19yrs, White, USA-born

100

MSM, 21yrs, White, USA-born

98

MSM, 25yrs, Latino/Hispanic, USA-born

99

MSM, 20yrs, Black/African American, USA-born

0.005

“MSM” Transmission Channel

  • This cluster of 4 represents the “MSM” Transmission Channel.


Characteristics of msm clusters
Characteristics of MSM clusters Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010


Msm idu transmission channel

MSM Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010, 48yrs, White, Unknown origin, K103N

99

100

MSM, 41yrs, White, USA-born, K103N

Male IDU, 31yrs,Black/African American, USA-born

0.005

“MSM/IDU” Transmission Channel

  • This cluster of 3 represents “MSM/IDU” Transmission Channel.


Idu het female transmission channel

Male Child, 2, Latino/Hispanic, USA-born Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

Female IDU,18, Latino/Hispanic, USA-born

100

Female HET, 39, Latino/Hispanic, USA-born

99

0.005

“IDU/HET Female” Transmission Channel

  • This cluster of 3 represents IDU/HET female transmission channel.


Msm het transmission channel

Female HET Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010,19, Latino/Hispanic, Mexico-born

100

Female HET , 35, Latino/Hispanic, USA-born

99

MSM, 56, Latino/Hispanic, Mexico-born

0.005

“MSM/HET” Transmission Channel

  • This cluster of 3 represents MSM/HET transmission channel.


Discussion
DISCUSSION Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

  • The results provide biological evidence for the major HIV transmission channels that have previously been established by traditional epidemiological data.

  • Small sample size limits the inferences that may be made based on this data.


Conclusions
CONCLUSIONS Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

  • Phylogenetic analysis has potential to serve as additional source of information to validate descriptions of local HIV epidemics inferred from self-reported behavioral data and case studies


No conflict of interest to disclose. Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010


Contact information
CONTACT INFORMATION Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

KwaSey PhD, MPH

600 S. Commonwealth Ave. Suite 1920

Los Angeles,CA90005

[email protected]


MSM Only Cluster- 75% Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

MSM/IDU Cluster- 13%

IDU/HET Cluster- 3%

MSM/HET Cluster- 6%

Other/Unknown Cluster- 3%

85% Boot strap Value Cutoff: 32 clusters, representing 110 cases, were identified. Each of these clusters comprised of 3-6 cases. The clusters were categorized into 5 cluster types. All were subtype B.


ad