Lecture 6

1. Lecture 6 Microbial Genetics: DNA Replication Gene Expression

2. Genetics • Genome= • Cells genome organized into chromosomes • Chromosome= • Gene= segment of the DNA that codes for one protein

3. Bacterial Chromosome • Single circular chromosome composed of DNA • Looped and folded and attached at one or more points to the plasma membrane • Supercoiled

4. Bacterial Plasmids • Many prokaryotic cells also contain plasmids • They replicate independently from the chromosome

5. Nucleic Acids 2 types of nucleic acids: Deoxyribonucleic acid (DNA) Ribonucleic acid (RNA) Subunit: Nucleotides

6. Nucleotide

7. Nitrogen containing bases 5 Different: Purines: Adenine (A) Guanine (G) Pyrimadines: Thyamine (T) Cystosine (C) Uracil (U)

8. Synthesis of DNA Dehydration synthesis- forming of covalent bonds between nucleotides Forms between phosphate group of one nucleotide and sugar of another nucleotide Phosphate joins #3 carbon of one sugar with #5 carbon of the other Results in backbone of alternating sugar and phosphate molecules

10. Double Helix of DNA Strand are held together by hydrogen bonds A pairs with T G pairs with C # of A= # of T # of G=# of C DNA sequence: read from 5’ to 3’ Sequence example: ATTAGCA etc.

14. DNA Replication

15. DNA Replication • Purpose is to create new DNA strand, so that upon binary fission, each of the 2 cells receives a complete copy of DNA • Bidirectional- from distinct starting point- proceeds in both directions • Semi- conservative- each of the 2 DNA helix’s generated contains 1 new strand and 1 old strand

16. First Stage: Initiation • DNA unwinds and strands separate • As the DNA unzips, two replication forks form and move in opposite directions away from the origin

17. Second Stage: Elongation • Enzymes synthesize a new stand to pair with each original strand • Nucleotides can only be added in 3’ to 5’ direction • This creates leading and lagging strands • The lagging strand is synthesized in Okazaki fragments, which are joined by DNA ligase

18. Figure 8.4

19. Third Stage: Termination • Two DNA helices separate from each other • Each chromosome now contains one old and one new strand

20. Figure 8.5

21. Figure 8.6b

22. Gene Expression: Transcription Translation

23. Central Dogma of Molecular Biology • DNA  RNA  Protein • Gene Expression: The production of a protein product from a gene • Involves two steps: transcription and translation

24. Gene Expression • Series of two processes that link genes to proteins • Transcription: synthesis of RNA from DNA • Translation: synthesis of protein from RNA

25. Transcription • DNA used as template • Use one strand of DNA to make mRNA molecule • mRNA is complementary to one strand of DNA

26. Initiation of Transcription • Transcription begins when RNA polymerase recognizes and binds to sequence of nucleotides in the DNA called the promoter • The promoter orients the RNA polymerase in one of two possible directions, telling it which DNA strand to use

27. Transcription- Elongation • RNA polymerase moves along template strand of DNA, synthesizing the complementary single-stranded RNA molecule • RNA synthesized in 5’ to 3’ direction, nucleotides added to 3’ end • Very fast: 30 nucleotides per second

28. Transcription- Termination • When RNA polymerase encounters terminator it falls off DNA • Once terminated RNA is called mRNA

29. Figure 8.7 (Overview) (1 of 7)

30. mRNA • Messenger RNA • Temporary copy of genetic information • 3 nucleotides of DNA  3 nucleotides of RNA • 3 nucleotides of RNA is a codon • One codon codes for one amino acid • String of amino acids with proper 3-D shape  protein

31. Translation • Process by which information on mRNA is decoded to synthesize the specified protein • Proteins synthesized by adding amino acids sequentially • Remember: one codon  one amino acid • How many amino acids would one protein contain if it was translated from an mRNA that is 690 nucleotides long?

32. AUGCGGCAGACCAAACGAUUGGUUGCGUAA • How many codons? 10 • List the codons: AUG CGG CAG ACC AAA CGA UUG GUU GCG UAA

33. The Genetic Code: Universal for all living things

34. Translation • Process of translation requires three major components • mRNA • Ribosomes • tRNA

35. Ribosomes • Serve as sites of translation, or sites of protein synthesis • Prokaryotic ribosomes are 70S • Large subunit- 50S • Small subunit- 30S

37. tRNA • Transfer RNA • Carries amino acids to the ribosome • Recognize and base-pair with a specific codon and deliver appropriate amino acid to site • Recognition occurs because each tRNA has an anti-codon, which is complementary to codon on mRNA

39. Initiation of Translation • Translation begins as the mRNA is still being synthesized • 30S subunit binds to ribosome-binding site • tRNA and 50S subunit soon join • AUG- start codon- codes for methionine

40. Elongation • Ribosome moves along mRNA • As the next codon is exposed, a new tRNA with correct anti-codon moves in • As each tRNA brings in the correct amino acid it forms a covalent bond to it’s neighboring amino acid • Elongation continues until stop codon is reached

42. Regulation of Gene Expression • Protein synthesis requires a huge amount of energy • Regulation of protein synthesis conserves energy for the cell • Repression and Induction • Operon model of gene expression

43. Repression and Induction • Repression: inhibits gene expression and decreases the synthesis of enzymes • Mediated by regulatory proteins called repressors • Induction: process that turns on the transcription of a gene • Mediated by regulatory proteins called inducers

44. Operon model of gene expression • Read over Operon Model of Gene Expression before class (page 229-231) • Work in groups to understand the concept