M B G 8 6 8 0

1. Rui Pires MartinsPhD Candidate, CMMG M B G 8 6 8 0 computer applications in molecular genetics

2. before we start… • changes to .login file? • created two directories in genetics • “traces” • “class” (or something??) • transferred a copy of files to “class” • by wsFTP or through Windows Mgb8680 | DNA sequencing

3. outline • DNA sequencing • chromatogram/trace data • chromas v.1.45 • staden suite • preGAP4 • GAP4 • trev • spin Mgb8680 | DNA sequencing

4. DNA sequencing jargon • read a DNA sequence • trace a chromatographic representation of DNA sequencing data • contiguous sequence several reads with common spans joined together • consensus the resulting sequence from several contigs that overlap • template “sense” strand • complement“anti-sense” strand 5’ ATTGGAGATCCGACTAATCCA 3’ 3’ TAACCTCTAGGCTGATTAGGT 5’ Mgb8680 | DNA sequencing

5. DNA sequencing AGTC TCAG Mgb8680 | DNA sequencing

6. fluorescent DNA sequencing Mgb8680 | DNA sequencing

7. each nucleotide is colour coded “good” sequence reads have well-defined peaks sequence traces Mgb8680 | DNA sequencing

8. sequence traces A A T T A T G T A A A T T • “bad” sequence isn’t so pretty and requires some practise to learn to “call” • if two peaks overlap, largest peaks “wins”, unless the peak encompasses more than one residue • “bad” sequence REQUIRES CONFIRMATION Mgb8680 | DNA sequencing

9. Chromas v.1.45 • basic chromatogram/trace reading/viewing programme for ab1 and scf files • freeware, works in Windows environments • some limited editing capabilities • examples: forward.ab1 & reverse.ab1 • Compare to forward.seq and reverse.seq Mgb8680 | DNA sequencing

10. Staden Suite Mgb8680 | DNA sequencing

11. Staden suite • very comprehensive suite of programmes for sequence analysis, manipulation and assembly • (was?) free to academics • preGAP4 processes/manipulates raw data prior to assembly • GAP4 (genome assembly) assembles/ manipulates processed reads into contigs; analyzes sequence integrity; organizes sequencing projects • trev trace viewing programme; can be used along GAP or on its own. Mgb8680 | DNA sequencing

12. Staden suite • examples: lb3.ab1, lb4.ab1, ub3l.ab1, ub3lup.ab1, ub4.ab1, ubml.ab1, ubmup.ab1 • vector file: pBSK+antisense5to3 • you will learn to read these files into preGAP4; process them; then assemble the files into a contig using GAP4. • trev will be used to edit the sequence reads • you will also learn to produce a finished sequence file that could be submitted to GenBank Mgb8680 | DNA sequencing

13. assignment • Finish the assembly of the 7 files into as long a contig as you can generate. Be sure to edit any sequence ambiguities as you go. Submit a final text file (fastA format) with this sequence. • Repeat the assembly. Only this time, shotgun all 7 files at once. What happened? Are there any advantages to the manual process? (HINT: you’ll have to create a new database in Staden to do this) • Use one of the trace readers/editors to edit the following residues from reverse.ab1 270 280 290 300 GCCCCTACACTCGNNNGCCTGCCCGCCTCTCAA • Assemble the forward.ab1 and reverse.ab1 files into a staden reads database. What is different this time (i.e. do you notice any annotations or tagged regions in the contigs; and if so what?) What advantages can you see to tagging these regions before you try to assemble them? email answers as text to rui@wayne.edu by Sunday night help/questions can also be directed to rui@wayne.edu or through MSN messenger (mutatethis@hotmail.com) Mgb8680 | DNA sequencing