Genetics of cancer
Download
1 / 37

Genetics of Cancer - PowerPoint PPT Presentation


  • 117 Views
  • Updated On :

Genetics of Cancer. Part 2 - January 23, 2007. Review. Two mutations must occur:. Review. Two mutations must occur: Protooncogene stuck in the “on” position (gas pedal down), constantly stimulating cell division. Review. Two mutations must occur:

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Genetics of Cancer' - hue


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Genetics of cancer l.jpg

Genetics of Cancer

Part 2 - January 23, 2007


Review l.jpg
Review

  • Two mutations must occur:


Review3 l.jpg
Review

  • Two mutations must occur:

  • Protooncogene stuck in the “on” position (gas pedal down), constantly stimulating cell division


Review4 l.jpg
Review

  • Two mutations must occur:

  • Protooncogene stuck in the “on” position (gas pedal down), constantly stimulating cell division

  • Tumor Suppressor Gene inactivated (brakes disconnected from accelerating car)


What else must happen l.jpg
What else must happen?

  • External controls overcome

  • Cells not limited by:

    • Crowding

    • Lack of attachment

    • Lack of nutrients

    • (remember “angiogenesis”?)


What else must happen6 l.jpg
What else must happen?

  • Telomerase must be present to create cellular immortality.


What else must happen7 l.jpg
What else must happen?

  • Telomerase must be present to create cellular immortality.

  • Most human cells divide 50-100 times before entering G0 permanently or committing cell suicide (apoptosis)


Telomerase l.jpg
Telomerase

  • OK, but…how does a cell know it has divided 50-100 times???


Telomerase9 l.jpg
Telomerase

  • OK, but…how does a cell know it has divided 50-100 times???

  • Tips of chromosomes are capped with a sequence of bases (TTAGGG) repeated 1000’s of times.

  • Each division removes 50-200 of these bases


Telomerase con t l.jpg
Telomerase, con’t

  • TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG


Shortening l.jpg
Shortening…

  • TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG


Shortening until l.jpg
Shortening, until…

  • TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG


Shortening until13 l.jpg
Shortening, until…

  • TTAGGGTTAGGGTTAGGG

  • It can’t divide any longer!


Stem cells l.jpg
Stem Cells

  • Stem cells produce cells (sex cells, blood, hair) that need to be replaced regularly - must keep dividing!


Stem cells15 l.jpg
Stem Cells

  • Stem cells produce cells (sex cells, blood, hair) that need to be replaced regularly - must keep dividing!

  • Telomerase is an enzyme that rebuilds the telomeres (adds TTAGGG)

  • If telomeres don’t get shorter, cells don’t get older


Back to cancer cells l.jpg
Back to cancer cells…

  • Cancer cells have a mutation that allows the production of telomerase.

  • Leads to cells being immortal that should die out.

  • Telomerase = gas tank!


Metastasis must spread cancerous cells l.jpg
Metastasis must spread cancerous cells

  • Cells spread via the circulatory or lymphatic system

  • 99% of cancer cells die en route, but some lodge in capillaries or lymph nodes

  • Cancer cells can break down material between cells to travel within tissues, leading to new colonies


Cancer and inheritance l.jpg
Cancer and inheritance

  • Two-hit hypothesis: TSG’s are inherited in pairs and both copies must be mutated


Cancer and inheritance19 l.jpg
Cancer and inheritance

  • Inherited one mutant TSG? You’re prone to developing cancer early in life (middle age or earlier)

  • Two good TSG’s? Cancer may come later in life, if at all.


Cancer and inheritance20 l.jpg
Cancer and inheritance

  • Inheritance is only a small part of developing cancer (colon cancers are inherited 15% of the time, breast 7%)

  • Environmental factors often more important determinant


Slide21 l.jpg
p53

  • “THE GUARDIAN OF THE GENOME”


Slide22 l.jpg
p53

  • “THE GUARDIAN OF THE GENOME”

  • Your primary TSG

  • Mutated in 55% of all cancers


Slide23 l.jpg
p53

  • Activated when DNA damage is bad

  • 1st - Halts cell cycle


Slide24 l.jpg
p53

  • Activated when DNA damage is bad

  • 1st - Halts cell cycle

  • 2nd - Starts DNA repair and restarts cell cycle if successful


Slide25 l.jpg
p53

  • Activated when DNA damage is bad

  • 1st - Halts cell cycle

  • 2nd - Starts DNA repair and restarts cell cycle if successful

  • 3rd - Causes apoptosis (cell suicide) if repair unsuccessful


Review26 l.jpg
Review

  • Gas pedal =


Review27 l.jpg
Review

  • Gas pedal = protooncogene


Review28 l.jpg
Review

  • Gas pedal = protooncogene

  • Brake =


Review29 l.jpg
Review

  • Gas pedal = protooncogene

  • Brake = tumor suppressor gene


Review30 l.jpg
Review

  • Gas pedal = protooncogene

  • Brake = tumor suppressor gene

  • Gas tank =


Review31 l.jpg
Review

  • Gas pedal = protooncogene

  • Brake = tumor suppressor gene

  • Gas tank = Telomerase (adds telomeres TTAGGG)


Review32 l.jpg
Review

  • Two-hit hypothesis?


Review33 l.jpg
Review

  • Two-hit hypothesis = BOTH copies of a TSG must be mutated


Review34 l.jpg
Review

  • Two-hit hypothesis = BOTH copies of a TSG must be mutated

  • Guardian of the cell?


Review35 l.jpg
Review

  • Two-hit hypothesis = BOTH copies of a TSG must be mutated

  • Guardian of the cell = p53


Review36 l.jpg
Review

  • Two-hit hypothesis = BOTH copies of a TSG must be mutated

  • Guardian of the cell = p53

  • Cell suicide?


Review37 l.jpg
Review

  • Two-hit hypothesis = BOTH copies of a TSG must be mutated

  • Guardian of the cell = p53

  • Cell suicide = apoptosis


ad