MiR319:   CCUCGAGGGAAGUCAGGUUU
Download
1 / 1

pyruvate + 3PGA - PowerPoint PPT Presentation


  • 82 Views
  • Uploaded on

miR319: CCUCGAGGGAAGUCAGGUUU :::::::: :.::::.::: Target: UGAGCUCCCCUUAGUCUAAA. Carbon fixation. Sucrose Starch. Sugars. Glycolysis. Pyruvate. pyruvate + 3PGA. Acetyl-COA. MEP. HMG-CoA. IPP. DMAPP. MVA. GGPS. DMAPP. IPP. GGPP.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' pyruvate + 3PGA' - hovan


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

miR319: CCUCGAGGGAAGUCAGGUUU

:::::::: :.::::.:::

Target: UGAGCUCCCCUUAGUCUAAA

Carbon fixation

Sucrose

Starch

Sugars

Glycolysis

Pyruvate

pyruvate + 3PGA

Acetyl-COA

MEP

HMG-CoA

IPP

DMAPP

MVA

GGPS

DMAPP

IPP

GGPP

miR1857: GCUACGAAGUUUUUUUAGGU

::. ::::...:::::::::

LYCB: CGGGGCUUUGGAAAAAUCCA

GGPP

phytoene

FPP

lycopene

phytosterols

LYCB

LYCB

a-carotene

b-carotene

CYTOSOL

lutein

Xanthoxin

PLASTID


ad