153
This presentation is the property of its rightful owner.
Sponsored Links
1 / 1

XhoI- AscI-PmeI-PacI -XhoI (5944) PowerPoint PPT Presentation


  • 74 Views
  • Uploaded on
  • Presentation posted in: General

153 pLVPT-tTRKRAB-H1SiDsred 11960 bp. XhoI- AscI-PmeI-PacI -XhoI (5944). H1-SiRNA Dsred. 300pb. Clonage H1-SiRNA dans sites AscI PacI. AscI -Xho H1 PROMOTEUR HindIII -MluI CCGCTCCAAGGTGTACGT GAA TTC AAGAGA TTCACGTACACCTTGGAGCTTTTTGGAAACGCGT SalI PacI.

Download Presentation

XhoI- AscI-PmeI-PacI -XhoI (5944)

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Xhoi asci pmei paci xhoi 5944

153

pLVPT-tTRKRAB-H1SiDsred

11960 bp

XhoI-AscI-PmeI-PacI-XhoI(5944)

H1-SiRNA Dsred

300pb

Clonage H1-SiRNA dans sites AscI PacI

AscI-Xho H1 PROMOTEURHindIII-MluICCGCTCCAAGGTGTACGTGAATTCAAGAGA

TTCACGTACACCTTGGAGCTTTTTGGAAACGCGTSalIPacI


  • Login