Dna and protein synthesis
Download
1 / 47

DNA and Protein Synthesis - PowerPoint PPT Presentation


  • 130 Views
  • Uploaded on

DNA and Protein Synthesis. Nucleic Acid Review. Name of the molecule identified by the arrow:. Phosphate group Nitrogen base Adenine Sugar. Name given to the circled structure:. Nucleic acid Amino acid Nucleotide Nucleus. The type of reaction responsible for joining molecules A and B.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' DNA and Protein Synthesis' - hallie


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Nucleic acid review

Nucleic Acid Review


Name of the molecule identified by the arrow
Name of the molecule identified by the arrow:

  • Phosphate group

  • Nitrogen base

  • Adenine

  • Sugar


Name given to the circled structure
Name given to the circled structure:

  • Nucleic acid

  • Amino acid

  • Nucleotide

  • Nucleus



Let’s assume the following strand of DNA contains the information needed to make a protein. This segment of DNA is known as a____:

  • Nucleotide

  • Codon

  • Translation

  • Gene

  • mRNA


Which is single stranded
Which is single stranded? information needed to make a protein. This segment of DNA is known as a____:

  • DNA

  • RNA


Which one can exit the nucleus
Which one can exit the nucleus? information needed to make a protein. This segment of DNA is known as a____:

  • DNA

  • RNA


The two strands of dna are bonded together in the middle by their
The two strands of DNA are bonded together in the middle by their…

  • Sugars

  • Phosphates

  • Nitrogen bases



Dna is
DNA is … their…

  • Single stranded

  • Double stranded

  • Triple stranded


Every nucleotide is made up of
Every nucleotide is made up of… their…

  • Sugar

  • Phosphate

  • Nitrogen base

  • All of the above


Nucleic acids function
Nucleic Acids - Function their…

  • Control the processes of heredity by which cells and organisms reproduce proteins.


Nucleic acids types
Nucleic Acids – Types their…

  • DNA

    • Deoxyribonucleic Acid

  • RNA

    • Ribonucleic Acid


Do you remember dna structure
Do you remember DNA structure? their…

SUGAR

Phosphate



Protein synthesis
Protein Synthesis their…

  • It’s a process

    • DNA -> RNA -> Amino Acids (Protein)


RNA their…

  • Sugar is Ribose NOT what…

  • Has nitrogen base Uracil instead of Thymine

    • Also contains the other 3 bases…what are they?

  • Only single stranded


RNA their…


Three processes in this unit
Three processes in this unit… their…

  • 1. Replication (DNA DNA)

  • 2. Transcription (DNA mRNA)

  • 3. Translation (RNA Protein)


A dna replication
A. DNA Replication their…

  • Occurs in the nucleus prior to any cell division

  • Enzyme is used to “unzip” or “unwind” the DNA

    • Forms a bubble at the origin site


Dna replication cont
DNA Replication (cont.) their…

  • Another enzyme is used to build a complementary strand of DNA from the template piece of original DNA

    • Nitrogenous bases pair up

      • A – T

      • C - G

  • As a result, you create two identical strands of DNA


Let s practice
Let’s Practice their…

  • Replicate the following strand of DNA using the correct nitrogenous bases:

    ATCGGCTATTAGGCATATCCGACGGTC

    TAGCCGATAATCCGTATAGGCTGCCAG



Transcription
Transcription their…

  • 1.) DNA strand unzips

    • The bonds between the nitrogen bases are broken

    • Initiated by RNA polymerase (enzyme) binding to promoter site on DNA

  • 2.) A single strand of mRNA (messenger RNA) is made

    • Pair up the bases

      • A

      • T

      • C

      • G

        The mRNA then travels from nucleus to cytoplasm


Transcription1
Transcription their…


Where in the cell does transcription take place
Where in the cell does transcription take place? their…

  • Cytoplasm

  • Mitochondria

  • Nucleus

  • Golgi Body

  • Vacuole


Any given segment of dna has directions that make unique what
Any given segment of DNA has directions that make unique what?

  • Glucose

  • Proteins

  • Lipids

  • Blood cells


If a DNA strand has the following sequence of base pairs – A C T G G T C C A A , then the mRNA strand would have what sequence?

  • T G A C C A G G T T

  • A C T G G T C C A A

  • T G U C C U G G T T

  • U G A C C A G G U U


Why is mrna called messenger rna
Why is mRNA called messenger RNA? A C T G G T C C A A , then the mRNA strand would have what sequence?

  • Because it carries the directions to make a protein to the ribosome like a message


Actually 3 types of rna
Actually 3 types of RNA A C T G G T C C A A , then the mRNA strand would have what sequence?

  • mRNA- messenger

    • Brings message from nucleus to ribosomes in cytoplasm

  • rRNA- ribosomal

    • Make up a ribosome

  • tRNA- transfer

    • “transfers” amino acids from the cytoplasm to the ribosome to be added to the chain


The difference between rna and dna is what
The difference between RNA and DNA is what? A C T G G T C C A A , then the mRNA strand would have what sequence?

  • The phosphates

  • The sugars

  • The nitrogen bases

  • The way the monomer units bond


Mrna is synthesized in the nucleus and travels to the cytoplasm to meet up with which organelle
mRNA is synthesized in the nucleus and travels to the cytoplasm to meet up with which organelle?

  • Mitochondria

  • Ribosome

  • Golgi Body

  • Lysosome

  • Nucleus


Translation
Translation cytoplasm to meet up with which organelle?

1. mRNA meets up with a ribosome…why??

  • Ribosomes are the site for protein production

    2. tRNAmolecules bring amino acids to ribosomes

    3. An mRNA codon will pair with a tRNAanticodon

  • Codon: 3 Nitrogen base sequence in mRNA that specifies a specific amino acid

  • Anticodon: 3 Nitrogen base sequence in tRNA


Translation cont
Translation (cont.) cytoplasm to meet up with which organelle?

  • As tRNA’s are added, amino acids are bonded together and will be released as a fully functional protein.


That s the process now how do you know what amino acids make up a particular protein
That’s the process, Now how do you know what amino acids make up a particular protein

  • We use an mRNA codon chart


Where in the cell does transcription the first part of protein synthesis take place
Where in the cell does transcription, the first part of protein synthesis, take place?

  • Mitochondria

  • Nucleus

  • Ribosomes

  • Cytoplasm


Dna has the directions to make what
DNA has the directions to make what? protein synthesis, take place?

  • Glucose

  • Nucleotides

  • Proteins

  • Monosaccharides


After a strand of mrna is made where does it go
After a strand of mRNA is made where does it go? protein synthesis, take place?

  • Ribosome

  • Mitochondria

  • Lysosome

  • Vacuole


Where in the cell does translation the second part of protein synthesis take place
Where in the cell does translation, the second part of protein synthesis, take place?

  • Mitochondria

  • Nucleus

  • Golgi body

  • Cytoplasm


Molecules called trna s are floating around the cytoplasm carrying what
Molecules called tRNA’s are floating around the cytoplasm carrying what?

  • mRNA’s

  • Glucose

  • DNA

  • Nucleotides

  • Amino Acids



Using your mrna codon chart what amino acid would a ribosome call for if the codon was a a c
Using your mRNA codon chart, what amino acid would a ribosome call for if the codon was A A C ?

  • Phenylalanine

  • Glutamine

  • Asparagine

  • Lysine

  • Tyrosine


What protein would be synthesized from the following mrna strand a c u u u c g a a u a c
What protein would be synthesized from the following mRNA strand?A C U U U C G A A U A C

  • Threonine – phenylalanine – glutamate – tyrosine

  • Phenylalanine – leucine – methionine – valine

  • Tyrosine – glutamate – phenylalanine – threonine

  • Lysine – cysteine – arginine – histidine


What protein would be synthesized from the following dna segment t a a g t a c g c t a g
What protein would be synthesized from the following DNA segment?T A A G T A C G C T A G

  • Isoleucine – alanine – histidine – alanine

  • Isoleucine – histidine – alanine – isoleucine

  • Phenylalanine – leucine – valine – arginine

  • Isoleucine – leucine – threonine – lysine



ad