dna and the genetic code
Download
Skip this Video
Download Presentation
DNA and the Genetic Code

Loading in 2 Seconds...

play fullscreen
1 / 39

DNA and the Genetic Code - PowerPoint PPT Presentation


  • 84 Views
  • Uploaded on

DNA and the Genetic Code. Larry J. Scheffler Lincoln High School 2009. 1. DNA. First isolated from the nuclei of cells in 1869 Oswald Avery (1944) presented evidence that suggested that nucleic acids were involved in the storage and transfer of genetic information.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' DNA and the Genetic Code' - gur


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
dna and the genetic code

DNA and the Genetic Code

Larry J. Scheffler

Lincoln High School

2009

1

slide2
DNA
  • First isolated from the nuclei of cells in 1869
  • Oswald Avery (1944) presented evidence that suggested that nucleic acids were involved in the storage and transfer of genetic information.
  • Erwin Chargaff found that the DNA always contains the same relative amounts of certain pairs of amine bases. There are always equal amounts of
      • adenine and thymine.
      • guanine and cytosine.
  • James Watson and Francis Crick in

1953 determined the structure of DNA

as a double helix.

  • Rosalind Franklin created the early X-ray diffraction pictures of DNA.

2

nucleic acids
Nucleic Acids
  • Nucleic acidsfall into two classes,

-- DNA

-- RNA

  • RNA, or Ribonucleic Acid, is built on the ß-D-ribofuranose ring.
  • DNA, or deoxyribonucleic acid, is based on a modified ribofuranose ring in which the -OH group on the second carbon atom has been removed.

3

dna structure
DNA Structure

DNA is made up of three units including:

I. A ribose sugar

Ribose

Deoxyribose

Ribose and deoxyribose differ in that ribose has an OH group on carbon 2 whereas deoxyribose has only a hydrogen attached.

4

dna structure1
DNA Structure

DNA is made up of three units including

I. A ribose sugar

II. A phosphate group

The phosphates are attached at carbons 3 & 5. This defines the direction of the chain.

5

3

Phosphate

Deoxyribose

The phosphate groups alternate with the ribose sugar and are attached at carbon 3 and at carbon 5

5

dna structure2
DNA Structure

DNA is made up of three units including

I. A ribose sugar

II. A phosphate group

III. A nitrogen (amine) base

There are four different amine bases: adenine, thymine, cytosine, and guanine.

6

a nucleotide
A Nucleotide

The DNA strand is made up of alternating deoxyribose and phosphate groups with a nitrogen base attached as a side chain.

Cytosine

7

dna structure3
DNA Structure

DNA is made up of three units

  • A ribose sugar
  • A phosphate group
  • A nitrogen (amine) base

The amine bases are side branches to a strand made

of alternating phosphate and deoxyribose sugars.

These bases are attached at carbon 1 of the deoxyribose sugar.

Adenine

Cytosine

8

dna structure4
DNA Structure

DNA is made up of three units:

    • A ribose sugar
    • A phosphate group
    • A nitrogen (amine) base
  • These three molecules make up a nucleotide.
  • A DNA strand is a sequence of nucleotides.
  • The phosphates are attached at carbon 3 and carbon 5.
  • The nitrogen bases are side chains at carbon 1.

Adenine

Cytosine

9

dna structure5
DNA Structure
  • DNA consists of two strands of nucleotides. These strands are wound together in a spiral known as a double helix
  • The amine bases hold the strand together with a

sequence

of hydrogen

bonds

10

complimentary bases
Complimentary Bases
  • Because of their size and their ability to hydrogen bond, the amine bases exist in complimentary pairs in the DNA double helix
  • Adenine always bonds with Thymine and Guanine always bonds with Cytosine

11

hydrogen bond alignment
Hydrogen Bond Alignment
  • The size and shape of the amine bases is such that hydrogen bonds can only form at specific sites
  • Adenine only bonds with Thymine
  • Guanine only bonds with Cytosine
  • Therefore they form complimentary base pairs

12

dna structure hydrogen bonding
DNA Structure -- Hydrogen Bonding
  • Adenine and Thymine form a base pair

13

dna structure hydrogen bonding1
DNA Structure Hydrogen Bonding
  • Guanine and Cytosine

14

base pair sequence
Base Pair Sequence
  • The sequences of bases appears to be random but in reality nothing is farther from the truth. The base pair sequence contains the code by which proteins are synthesized in the cell

15

dna structure6
DNA Structure
  • In the double helix of a DNA molecule, the two strands are not parallel, but interwoven with each other. 
  • The helix makes a turn every 3.4 nm, and the distance between two neighboring base pairs is 0.34 nm. 
  • There are about 10 pairs per turn. 
  • The intertwined strands make two grooves of different widths, known as the major groove and the minor groove.
  • These grooves may facilitate binding with specific proteins.

16

dna shape
DNA Shape
  • This color enhanced image taken by the Scanning Tunneling Electron Microscope shows a double helix

17

dna replication
DNA Replication
  • In human beings there are 23 pairs of chromosomes
  • Chromosomes are effectively a very long DNA sequence. This DNA sequence replicates itself during cell division
  • As the DNA double helix partially unzips as the hydrogen bonds between the nitrogen bases are broken
  • Sugar and base units are picked up from the surrounding solution.
  • Since only A –T and G-C combinations can occur the new strand is a complimentary replicate of the existing DNA

18

dna replication1
DNA Replication
  • When cells divide the DNA must is replicated exactly
  • As the DNA unzips new complimentary strands are formed.
  • These new strands are exact replicas of the previously existing strands

19

dna and the genetic code1
DNA and the Genetic Code
  • Genes are long sequences of DNA that code for the formation of proteins
  • Typical genes are often thousands of base pairs long
  • Not all of the DNA strand appears to have genetic information
  • The sequence for a particular gene is very specific.

20

gene correspondance for neuropilin 1
Gene Correspondance for Neuropilin-1

SpeciesbpNP-1 Sense PrimerMacaque -- ACCCGCACCTCATTCCTACATCAATGAGTGGCTCCAAATAGACCTGGGGGHuman 1422ACCCGCACCTCATTCCTACATCAATGAGTGGCTCCAAATAGACCTGGGGGRat1419ACCCTCACCCCACCCATACATCAATGAATGGCTCCAAGTGGACCTGGGAGMacaqueAGGAGAAGATCGTGAGGGGCATCATCATTCAGGGTGGGAAGCACCGAGAGHuman1472AGGAGAAGATCGTGAGGGGCATCATCATTCAGGGTGGGAAGCACCGAGAGRat1469ATGAGAAGATAGTAAGAGGTGTCATCATTCAAGGTGGGAAGCACCGAGAAMacaqueAACAAGGTATTCATGAGGAAGTTCAAGATCGGGTACAGCAACAACGGCTCHuman 1522AACAAGGTGTTCATGAGGAAGTTCAAGATCGGGTACAGCAACAACGGCTCRat1519AACAAAGTGTTCATGAGGAAGTTCAAGATCGCCTACAGTAACAATGGTTC

MacaqueCGACTGGAAGATGATCATGGACGACAGCAAACGCAAGGCAAAGTCTTTTGHuman 1572GGACTGGAAGATGATCATGGATGACAGCAAACGCAAGGCGAAGTCTTTTGRat1569TGACTGGAAAATGATCATGGATGACAGCAAGCGCAAGGCTAAGTCTTTTGMacaqueAGGGCAACAACAACTATGACACACCTGAGCTGCGGACTTTTCCAGCTCTCHuman1622AGGGCAACAACAACTATGATACACCTGAGCTGCGGACTTTTCCAGCTCTCRat1619AAGGCAACAACAACTATGACACACCTGAGCTCCGGGCCTTTACACCTCTCMacaqueTCCACGCGATTCATCAGGATCTACCCCGAGAGAGCCACTCATGGCGGACTHuman 1672TCCACGCGATTCATCAGGATCTACCCCGAGAGAGCCACTCATGGCGGACTRat1669TCCACAAGATTCATCAGGATCTACCCCGAGAGAGCCACACATAGTGGGCT -NP-1 Anti-sense Primer (reverse)

MacaqueGGGGCCCCGAATGGAGCTGCTGGGCTGTGAAGTGGAAHuman1722GGGGCTCAGAATGGAGCTGCTGGGCTGTGAAGTGGAARat1719CGGACTGAGGATGGAGCTACTGGGCTGTGAAGTAGAA

21

protein synthesis
Protein Synthesis
  • DNA is found in the chromosomes which are found in the nucleus of the cell
  • DNA stores the genetic code for an organism through its sequence of the nitrogen bases
  • The genetic code is transferred via RNA to the ribosomes in the cytoplasm outside of the cell nucleus where protein in synthesized
  • The information required for protein synthesis is passed through a similar unzipping and replication process

22

rna and protein synthesis
RNA and Protein Synthesis
  • The transfer of information for building proteins is then accomplished by the RNA.
  • RNA is similar to DNA but there are some important differences
      • RNA is a single strand rather than a double helix
      • Deoxyribose is replaced with ribose
      • The nitrogen base thymine is replaced with uracil

23

rna structure
RNA Structure
  • Ribose has a slightly different structure from deoxyribose.
  • Ribose has an –OH group on carbon 2 rather than a H as in deoxyribose.

24

rna v dna
RNA v DNA
  • The structure of Uracil differs only slightly from Thymine

Thymine has a methyl side group

Uracil

Thymine

25

messenger rna
Messenger RNA
  • Messenger RNA or mRNA copies and carries the genetic code from the DNA template within the cell nucleus to the ribosomes where proteins are synthesized.
  • It essentially aligns itself with the DNA and produces a complimentary copy

26

messenger rna1
Messenger RNA
  • Messenger RNA (mRNA) acts as a template for protein synthesis
  • It has the same sequence of bases (in the 5\' to the 3\' direction) as the DNA strand that holds the gene sequence.
  • mRNA strands can range from 300 to as many as 7000 nucleotides.
  • The length depends on the size and the number of proteins related to the code.

27

transfer rna
Transfer RNA
  • Transfer RNA acts as an amino acid carrier in the formation of proteins.
  • Through a decoding mechanism it facilitates the addition of an amino acid to a peptide chain forming a protein.
  • It directs the insertion of amino acids in the proper sequence in the poly peptide chain through sets of three nitrogen bases known as codons.

28

transfer rna1
Transfer RNA
  • tRNA molecules are covalently attached to the corresponding amino-acid at one end, and at the other end they have a triplet sequence (called the anti-codon) that is complementary to the triplet codon on the mRNA.
  • All tRNA molecules are in the range ~70-90 nucleotides. They have a molecular weight of ~25,000

29

ribosomal rna
Ribosomal RNA
  • Ribosomal RNA (rRNA)is one of the structural components of a cell structure known as a Ribosome.
  • Ribosomes structurally support and catalyze protein synthesis.

31

dna replication during cell division
DNA Replication During Cell Division
  • During cell replication the DNA unwinds and each strand builds a new complimentary strand.

32

rt pcr or reverse transcriptase polymerase chain reactions
RT-PCR or Reverse Transcriptase Polymerase Chain Reactions
  • RT-PCR was first developed by Cary Mullis for which he was awarded the Nobel Prize in Chemistry
  • Replicated DNA can be then separated and classified
  • This process allows the DNA from very small amounts of
  • cellular material to be replicated
  • DNA is extracted and broken down into smaller fragments
  • using restriction enzymes
  • The DNA is then replicated and separated using gel
  • electrophoresis

33

rt pcr and dna replication
RT-PCR and DNA Replication

400 bp

300 bp

200 bp

NP-1

100 bp

Cyclo

Primers

CTRL

EARLY

MID

MID

LATE

LATE

MENSE

RT-PCR gel showing relative amounts of NP-1 using cyclophilin as an internal standard.

34

dna sequencing
DNA Sequencing

Dr. Lee Hood (Univ. of Washington) invented a device that can sequence the bases for a DNA fragment.

35

forensic dna analysis
Forensic DNA Analysis
  • The DNA fragment contains codons that code for proteins
  • It also contains regions where there is no coded message in the base sequence
  • The application of a restriction enzyme cuts this part of
  • the DNA into fragments.
  • The sequence and hence the fragment sizes are unique
  • for each individual (Except for Identical Twins)

36

dna fingerprinting process
DNA Fingerprinting Process

DNA fingerprinting is a multistep process.

37

forensic dna analysis1
Forensic DNA Analysis
  • Used to identify people in criminal cases.
  • Used to establish identity, paternity and ancestry.
  • Used to study evolutionary changes in species.

38

forensic dna analysis2
Forensic DNA Analysis
  • DNA evidence is only as good as the person performing the tests. Care must be taken to guard against contamination for legal evidence to stand.
  • Chain of evidence rules

39

ad