Shrinking cost of your genome
This presentation is the property of its rightful owner.
Sponsored Links
1 / 34

Shrinking cost of your genome PowerPoint PPT Presentation


  • 56 Views
  • Uploaded on
  • Presentation posted in: General

Shrinking cost of your genome. Million-fold in 6 years. What does $0 to the consumer mean?. Web 2.0, Crowd-sourcing. 2001 Wikipedia 1998 Search, Maps, Translation. But these new technologies (cell phone, fax, PC) are only as good as their communities. 1. Expensive 2. Discriminative

Download Presentation

Shrinking cost of your genome

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Shrinking cost of your genome

Million-fold

in 6 years


What does $0 to the consumer mean?

Web 2.0,

Crowd-sourcing

2001 Wikipedia

1998 Search, Maps, Translation ..

But these new technologies (cell phone, fax, PC) are only as good as their communities.


1. Expensive

2. Discriminative

3. Worthless

The Personal Genome: Do I want to know? 

Genetic Information Nondiscrimination Act of 2008

(GINA)

Employment & health insurance


  • Ethnicity

  • Sexuality GLBT

  • Cancer

  • Facebook.com

  • PatientsLikeMe.com

    • - HIV-AIDS

    • - Neurodegenerative Disorders

    • - Psychiatric Meds

Destigmatizationvs enhanced hiding(addressing causes vs symptoms)


DNA Explorer, $80 (Ages 10 and up)

DIY Bio

Genographic $99

23andme $399


Newborns are tested for up to 40 traits (e.g. PKU)

1526 Highly Predictable & actionable gene tests (not SNP chips)

As with security/insurance purchases, we are all at risk, even though we don’t expect to see direct payback.


  • 50% to 75% get good news

  • and for the rest:

  • Planning – family, geography

  • Research activism

The Personal Genome: Do I want to know, if there will be no medical action?


Individually rare collectively common: Breast cancer

deCODEme: “does not include the high-risk but rare BRCA1 and BRCA2 breast cancer risk variants”.

Navigenics: “Mutations in BRCA1 or BRCA2 are less common in the population and are only present in approximately 5 – 10% of families with breast and ovarian cancer.”

23andme: “Hundreds of cancer-associated BRCA1 and BRCA2 mutations have been documented, but three specific BRCA mutations are worthy of note because they are responsible for a substantial fraction of hereditary breast cancers and ovarian cancers among women with Ashkenazi Jewish ancestry”.

1M vs 3G


Valuable Personal Genome Sequences

1464 genes are highly predictive & medically actionable (inherited & cancer) at ~$2K per gene.

**Very few of these are on DTC SNP chips.** Why?

PKU, Tay Sachs, Cystic Fibrosis, BRCA1/2, etc.

Pharmacogenomic drug/allele combinations:

Herceptin, Iressa, ..

Also:

Ancestry, Forensics,

Social Networking,

Education, Research


snp.med.harvard.edu


Anonymity vs Open-access?

Trends in laws to make data public (not just at elite institutions):e.g.H.R. 2764, SEC. 218. 26-Dec-07 open-access publishing for all NIH-funded research.

(12) Identify individual case/control status from pooled SNP data Homer et al PLoS Genetics 2008as this became known, NCBI pulled dbGAP data

(11) Re-identification after “de-identification” using public data. Group Insurance list of birth date, gender, zip code sufficient to re-identify medical records of Governor Weld & family via voter-registration records (1998)

Self identification trend

(10) Unapproved self-identification. e.g. Celera IRB. (Kennedy Science. 2002)

(9) Obtaining data about oneself via FOIA or sympathetic researchers.

(8) DNA data CODIS data in the public domain.

even if acquitted


Anonymity vs Open-access?

Accessing “Secure data”

(7) Laptop loss. 26 million Veterans' medical records,

SSN & disabilities stolen Jun 2006.

(6) Hacking. A hacker gained access to confidential medical info at the U. Washington Medical Center -- 4000 files (names, conditions, etc, 2000)

(5) Combination of surnames from genotype with geographical info An anonymous sperm donor traced on the internet 2005 by his 15 year old son who used his own Y chromosome data.

(4) Identification by phenotype. If CT or MR imaging data is part of a study, one could reconstruct a person’s appearance . Even blood chemistry can be identifying in some cases.

(3) Inferring phenotype from genotypeMarkers for eye, skin, and hair color, height, weight, geographical features, dysmorphologies, etc. are known & the list is growing.

(2) “Abandoned DNA bearing samples (e.g. hair, dandruff, hand-prints, etc.)

(1) Government subpoena. False positive IDs and/or family coercion

index


Motivating, donating, raising consciousness

Who can contribute to cures & prevention?

Huntington'sNancyWexler(psychologist)

HFE Aull

(engineer)

Adrenoleukodystrophy

Odone(World Bank)

ALSJamie Heywood(engineer)

PatientsLikeMe.com

Parkinson’s

Brin family

Hugh Rienhoff, (MD)

MyDaughtersDNA.org

LRRK2 G2019S


Genesenvironmentstraits, cells

1660

0431

1846

1070

1730

1677

1687

1731

1833

1781

1) First & only open access data

2) Avoid over-promising on de-identification

3) 100% onExam to assure informed consent

(*Educate pre-consent rather than post-discovery*)

4) Low costwhole genome sequences

5) Multiple-traits: images, stem cells, etc.

6) IRB approval for 100,000 diverse volunteers

15,000 since May 2009

501(c)(3)


  • Exercise

  • Drink your milk

  • Eat your beans

  • & your grains

  • & your iron

  • Get more rest

Generic Health Advice


  • ExerciseHCM

  • Drink your milkMCM6

  • Eat your beansG6PD

  • & your grainsHLA-DQ2

  • & your ironHFE

  • Get more restHLA-DR2

UNLESS …


Diagnostics Systems Biology Challenge

NOT going from ONLY Genome Sequence

to Prediction

TRAITS

(Phenome)

Genome

6 Gbp

3M Alleles


PersonalGenomes.orgInherited, Somatic, Environmental Genomics

One in a life-time genome + yearly ( to daily) tests

Public Health Bio-weathermap.org : Allergens, Microbes, Viruses

VDJ-ome

Personal stem-cells

epigenome (RNA,mC)

PERSONAL GENOME

6 Gbp

3M alleles

TRAITS

(Phenome)

Microbiome

~5 new non-synonymous

Alleles per generation


Even far from hospitals & farms

Morten

Sommer

Gautam

Dantas


Even far from hospitals & farmsare multi-drug resistant microbes

Researchers Find Bacteria

That Devour Antibiotics


Microbiome vsVDJ-ome

Microbe tests: Detect Drug resistance spectrum

Earlier warning (e.g. meningitis)

Immune tests: Focus on response to exposure

Longer times to detect exposure (e.g. HIV, TB)


Microbiomes: What limits diagnostics

  • Standard of practice: skip diagnostics; guess at pathogen & antibiotics

  • If diagnostic is used typically a fingerprint rather than cauastive sequences.

  • Ideally targeted sequencing of pathogenicity and resistance – and broad community updating mechanism.

  • Assay 25 microliters or 6 liters?


Vaccination VDJ-ome

HMS/MIT: Francois Vigneault, Uri Laserson, Erez Lieberman-Aiden, George Church

Roche: Michael Egholm, Birgitte Simen


Time Series Vaccine Experiment

Tracking human dynamic response to vaccination to 11 strains:

Hepatitis A+B, Flu A/Brisbane/59/2007 (H1N1)-like, 10/2007 (H3N2)-like, B/Florida/4/2006-like virus

Polio, Yellow fever

Meningococcus

Typhoid, Tetanus

Diptheria, Pertussis

Collect samples at

-14d, 0d,

+1d, +3d,

+7d, +14d,

+21d, +28d


V and J usage – CDR3 size distribution

SR1+SR2+TR1

IMGT/LIGM

FV


Self Organizing Map (SOM) clustering


Isotypes


Query: FXQ8H8O01DXEUI rank=0514859 x=1493.0 y=2520.0 length=408

Target: I55621 | anti-hepatitis B virus (HBV) surface antigen (HBsAg) (human)

Model: affine:local:dna2dna

Raw score: 1740

Query range: 8 -> 398

Target range: 27 -> 423

9 : CGCGTTGCTCTTTTAAGAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGG : 72

| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

28 : CTCGTTGCTCTTTTAAGAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGG : 91

73 : TCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGG : 136

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||

92 : TCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGGTATGG : 155

137 : CATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGAT : 200

||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||

156 : CATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTGATATCATATGAT : 219

201 : GGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCA : 264

||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||

220 : GGAAGTAATAAATGGTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCA : 283

265 : AGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGC : 328

||||||| |||| |||||||||| ||||||||||||||| |||||||| ||| |||||||||||

284 : AGAACACTCTGTTTCTGCAAATGCACAGCCTGAGAGCTGCGGACACGGGTGTATATTACTGTGC : 347

329 : GAGAGA---ACTT-ACTATGGTTCGGGGAGTTCCTG--ACTACTGGGGCCAGGGAACCCTGGTC : 386

|| ||| |||| ||| ||||||| |||| || | ||||||||| ||||||||||||||||

348 : GAAAGATCAACTTTACTTTGGTTCGCAGAGTCCCGGGCACTACTGGGTCCAGGGAACCCTGGTC : 411

387 : ACCGTCTCCTCA : 398

||||||||||||

412 : ACCGTCTCCTCA : 423

aln_summary: FXQ8H8O01DXEUI 408 8 398 + I55621 423 27 423 + 1740 390 372 95.38

UL


21-Jan-2010 Emphasis on Protein/cell function, Integration & Interpretation

-Personal Genome issues: cost, unfriendly databases,

consent, multiple genes + environmental factors

-Personal stem cells 3 uses: Diagnostic/inheritance,

therapeutic cells, test pharmaceuticals

-Microbiomes: What limits diagnostics

-VDJ-omes: How to generalize immune diagnostics

29


PGP skin to stem cells to ...

Lee J, Park IH, Gao Y, Li JB, Li Z, Daley G, Zhang K, Church GM (2009) A Robust Approach to Identifying Tissue-specific Gene Expression Regulatory Variants Using Personalized Human Induced Pluripotent Stem Cells. PLoS Genetics Nov 2009


PGP iPSC allele specific expression


iPSC-derived hepatic proteins & activity

Generation of Functional Human Hepatic Endoderm

from Human Induced Pluripotent Stem Cells

Gareth et al Hepatology. 2010 Jan;51:329-35.


1. Expensive: “If you think education is expensive .. try ignorance”

2. Discriminative: Destigmatize,

pass laws, educate

3. Worthless: If we share, .. priceless

The Personal Genome: Do I want to know? 


Four open-source resources

Polonator.org

snp.med.harvard.edu 

(Genes + Environment = Trait prediction)


  • Login