David goldberg cs 1950 directed study
Download
1 / 7

David Goldberg CS 1950 Directed Study - PowerPoint PPT Presentation


  • 113 Views
  • Uploaded on

David Goldberg CS 1950 Directed Study. RNA are the building blocks for life RNA is read by ribosome's which then create a functional product.(i.e. protein that the cell needs) Similarly to lines of code, RNA is instructions on how to build the most fundamental parts of a living thing.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' David Goldberg CS 1950 Directed Study' - felcia


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
David goldberg cs 1950 directed study

David Goldberg

CS 1950 Directed Study


  • RNA are the building blocks for life

  • RNA is read by ribosome's which then create a functional product.(i.e. protein that the cell needs)

  • Similarly to lines of code, RNA is instructions on how to build the most fundamental parts of a living thing.


Alternative pre-mRNA splicing generates widespread transcript diversity by specifying the inclusion or exclusion of sequences encoding protein functional domains. We are interested in understanding how these mechanisms are coordinated in the nervous system to tailor the structure of protein molecules for their specific roles at the synapse relating to neuronal communication and plasticity.


The sequences that I will be dealing with include the possible characters:

  • A, C, G, T

  • Y= C or T

  • R=A or G

  • N=A or C or T or G


Exon possible characters:

Down Intron

Up Intron

GATTACACATGCCGTAG

CCCACTCCATGATTACAC

CATGCCGTAGCTCATGCC

GCCACGTCTTTTGCTCTTTGCAGGATTACATCACTGGAAACTTTAGCCACGTAAACTTTA

Pattern 1:ACATCAC

Pattern 2:ACGT


Desired upgrades
Desired Upgrades possible characters:

Current Program:

  • Command line arguments only (2 patterns)

  • Cannot Use Y or R or N

  • Only Checks Human RNA for patterns

  • Has static search length

  • Result file displays Human RNA id, mouse RNA id, and last 75 characters.

  • Only Searches Down Intron

    New Program:

  • Better user interface

  • Ability to use Y,R and N

  • Control Lengths between patterns and length of search

  • Easier to decipher result file

  • Checks Human and Mouse RNA

  • Can search up or down introns and exons.


Possible problems
Possible Problems possible characters:

  • Programming in Perl

  • Extensive Use of Regular Expressions

  • Trouble figuring out exactly what is needed to be done

  • Don’t know if what we want to be done can be done


ad