David goldberg cs 1950 directed study
This presentation is the property of its rightful owner.
Sponsored Links
1 / 7

David Goldberg CS 1950 Directed Study PowerPoint PPT Presentation


  • 85 Views
  • Uploaded on
  • Presentation posted in: General

David Goldberg CS 1950 Directed Study. RNA are the building blocks for life RNA is read by ribosome's which then create a functional product.(i.e. protein that the cell needs) Similarly to lines of code, RNA is instructions on how to build the most fundamental parts of a living thing.

Download Presentation

David Goldberg CS 1950 Directed Study

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


David goldberg cs 1950 directed study

David Goldberg

CS 1950 Directed Study


David goldberg cs 1950 directed study

  • RNA are the building blocks for life

  • RNA is read by ribosome's which then create a functional product.(i.e. protein that the cell needs)

  • Similarly to lines of code, RNA is instructions on how to build the most fundamental parts of a living thing.


David goldberg cs 1950 directed study

Alternative pre-mRNA splicing generates widespread transcript diversity by specifying the inclusion or exclusion of sequences encoding protein functional domains. We are interested in understanding how these mechanisms are coordinated in the nervous system to tailor the structure of protein molecules for their specific roles at the synapse relating to neuronal communication and plasticity.


David goldberg cs 1950 directed study

The sequences that I will be dealing with include the possible characters:

  • A, C, G, T

  • Y= C or T

  • R=A or G

  • N=A or C or T or G


David goldberg cs 1950 directed study

Exon

Down Intron

Up Intron

GATTACACATGCCGTAG

CCCACTCCATGATTACAC

CATGCCGTAGCTCATGCC

GCCACGTCTTTTGCTCTTTGCAGGATTACATCACTGGAAACTTTAGCCACGTAAACTTTA

Pattern 1:ACATCAC

Pattern 2:ACGT


Desired upgrades

Desired Upgrades

Current Program:

  • Command line arguments only (2 patterns)

  • Cannot Use Y or R or N

  • Only Checks Human RNA for patterns

  • Has static search length

  • Result file displays Human RNA id, mouse RNA id, and last 75 characters.

  • Only Searches Down Intron

    New Program:

  • Better user interface

  • Ability to use Y,R and N

  • Control Lengths between patterns and length of search

  • Easier to decipher result file

  • Checks Human and Mouse RNA

  • Can search up or down introns and exons.


Possible problems

Possible Problems

  • Programming in Perl

  • Extensive Use of Regular Expressions

  • Trouble figuring out exactly what is needed to be done

  • Don’t know if what we want to be done can be done


  • Login