Initiation on your own sheet of paper
This presentation is the property of its rightful owner.
Sponsored Links
1 / 12

Initiation: (on your own sheet of paper) PowerPoint PPT Presentation


  • 81 Views
  • Uploaded on
  • Presentation posted in: General

Initiation: (on your own sheet of paper). What do you know about DNA? Have you ever seen DNA being used on TV or in movies? Why do you think it is important to study DNA?. Key Points Nucleotides are the building blocks of DNA.

Download Presentation

Initiation: (on your own sheet of paper)

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Initiation on your own sheet of paper

Initiation: (on your own sheet of paper)

What do you know about DNA?

Have you ever seen DNA being used on TV or in movies?

Why do you think it is important to study DNA?


Swbat describe the overall structure of the dna molecule

  • Key Points

  • Nucleotides are the building blocks of DNA.

  • Nucleotides are made of a Sugar, Phosphate, and Nitrogenous Base.

  • DNA is made of four types of nucleotides; Adenine, Thymine, Cytosine, and Guanine.

  • Each nucleotide binds specifically with another nucleotide. Adenine binds to Thymine and Cytosine binds to Guanine.

  • DNA has a double helix structure.   

SWBAT: Describe the overall structure of the DNA molecule.


Nucleotides are the building blocks of dna

Nucleotides are the building blocks of DNA.

Nucleotide

Nucleotide

Nucleotide

Nucleotide

Nucleotide


Nucleotides are made of a sugar phosphate and nitrogenous b ase

Nucleotides are made of aSugar,Phosphate, and NitrogenousBase.

Phosphate

Nitrogenous Base

Sugar


Initiation on your own sheet of paper

DNA is made of four types of nucleotides; Adenine, Thymine, Cytosine, and Guanine.

Each nucleotide binds specifically with another nucleotide. Adenine binds to Thymine and Cytosine binds to Guanine.  

Adenine

Thymine

Adenine

Thymine

Cytosine

Guanine

Guanine

Cytosine


Dna has a double helix structure

DNA has a doublehelix structure. 


Hemoglobin

Hemoglobin

TACCAAGTAGAATGAGGACTTCTCTTTTCACGACAGTGGCGGGAGATACCATTCCATCTACACCTGCTTCAACCGCCTCTACGTAATCCAGCAAACATC

  • Hemoglobin is a special protein found in our red blood cells.

  • This protein allows our RBC’s to carry oxygen.

  • Mutations in this protein can lead to Sickle Cell Anemia.


Build our own dna

Build our own DNA!!!

Your table will be responsible for building part of the hemoglobin DNA strand.

Identify your sequence of DNA.

Gather materials:

Toothpicks

Gum Drops

licorice ropes

Assign colors to specific nucleotides

Example: red = thymine

3. Build your DNA!


Termination

Termination:

Look at this single stranded segment of hemoglobin DNA…

TGAGGAC

What do each of the letters represent?

Write out the sequence of the complimentary strand.

Which part of the nucleotide is responsible for bonding with another nucleotide?

When these two strands are put together, what does the overall structure of the DNA molecule look like?


Initiation

Initiation:

Nucleotides are the building blocks of ______________.

Nucleotides are made of a ________, ____________, and ________________.

DNA is made of four types of nucleotides; __________, ______________, ____________, and ____________.

Each nucleotide binds specifically with another nucleotide. ____________ binds to _____________ and __________ binds to ____________.

DNA has a __________ _________ structure.


Berry full of dna

Berry Full of DNA!!!

Mash the strawberries into a slush.

2.Add detergent solution.

3.Filter the strawberry extract.

4.Layer the cold ethanol over filtered extract.


Termination1

Termination:

The first 12 nucleotides for that code for the hemoglobin protein are…

TACCAAGTAGAA

What is a nucleotide? Draw the basic structure and label its parts.

What is the sequence of the complimentary DNA strand?

T/F The structure of DNA is called a single helix

(If false, change one word to make it true)


  • Login