sequencing and assembly
Download
Skip this Video
Download Presentation
Sequencing and Assembly

Loading in 2 Seconds...

play fullscreen
1 / 34

Sequencing and Assembly - PowerPoint PPT Presentation


  • 74 Views
  • Uploaded on

Sequencing and Assembly. Cont’d. Steps to Assemble a Genome. Some Terminology read a 500-900 long word that comes out of sequencer mate pair a pair of reads from two ends of the same insert fragment contig a contiguous sequence formed by several overlapping reads

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Sequencing and Assembly' - fausto


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
steps to assemble a genome
Steps to Assemble a Genome

Some Terminology

read a 500-900 long word that comes

out of sequencer

mate pair a pair of reads from two ends

of the same insert fragment

contig a contiguous sequence formed

by several overlapping reads

with no gaps

supercontig an ordered and oriented set

(scaffold) of contigs, usually by mate

pairs

consensus sequence derived from the

sequene multiple alignment of reads

in a contig

1. Find overlapping reads

2. Merge some “good” pairs of reads into longer contigs

3. Link contigs to form supercontigs

4. Derive consensus sequence

..ACGATTACAATAGGTT..

2 merge reads into contigs
2. Merge Reads into Contigs
  • Overlap graph:
    • Nodes: reads r1…..rn
    • Edges: overlaps (ri, rj, shift, orientation, score)

Reads that come

from two regions of

the genome (blue

and red) that contain

the same repeat

Note:

of course, we don’t

know the “color” of

these nodes

2 merge reads into contigs1

repeat region

2. Merge Reads into Contigs

We want to merge reads up to potential repeat boundaries

Unique Contig

Overcollapsed Contig

2 merge reads into contigs2
2. Merge Reads into Contigs
  • Remove transitively inferable overlaps
    • If read r overlaps to the right reads r1, r2, and r1 overlaps r2, then (r, r2) can be inferred by (r, r1) and (r1, r2)

r

r1

r2

r3

2 merge reads into contigs4
2. Merge Reads into Contigs

repeat boundary???

sequencing error

  • Ignore “hanging” reads, when detecting repeat boundaries

b

a

b

a

repeats errors and contig lengths
Repeats, errors, and contig lengths
  • Repeats shorter than read length are easily resolved
    • Read that spans across a repeat disambiguates order of flanking regions
  • Repeats with more base pair diffs than sequencing error rate are OK
    • We throw overlaps between two reads in different copies of the repeat
  • To make the genome appear less repetitive, try to:
    • Increase read length
    • Decrease sequencing error rate

Role of error correction:

Discards up to 98% of single-letter sequencing errors

decreases error rate

 decreases effective repeat content

 increases contig length

slide10

3. Link Contigs into Supercontigs

Normal density

Too dense

 Overcollapsed

Inconsistent links

Overcollapsed?

slide11

3. Link Contigs into Supercontigs

Find all links between unique contigs

Connect contigs incrementally, if  2 forward-reverse links

supercontig

(aka scaffold)

slide12

3. Link Contigs into Supercontigs

  • Fill gaps in supercontigs with paths of repeat contigs
  • Complex algorithmic step
    • Exponential number of paths
    • Forward-reverse links
4 derive consensus sequence
4. Derive Consensus Sequence

TAGATTACACAGATTACTGA TTGATGGCGTAA CTA

Derive multiple alignment from pairwise read alignments

TAGATTACACAGATTACTGACTTGATGGCGTAAACTA

TAG TTACACAGATTATTGACTTCATGGCGTAA CTA

TAGATTACACAGATTACTGACTTGATGGCGTAA CTA

TAGATTACACAGATTACTGACTTGATGGGGTAA CTA

TAGATTACACAGATTACTGACTTGATGGCGTAA CTA

Derive each consensus base by weighted voting

(Alternative: take maximum-quality letter)

some assemblers
Some Assemblers
  • PHRAP
      • Early assembler, widely used, good model of read errors
      • Overlap O(n2)  layout (no mate pairs)  consensus
  • Celera
      • First assembler to handle large genomes (fly, human, mouse)
      • Overlap  layout  consensus
  • Arachne
      • Public assembler (mouse, several fungi)
      • Overlap  layout  consensus
  • Phusion
      • Overlap  clustering  PHRAP  assemblage  consensus
  • Euler
      • Indexing  Euler graph  layout by picking paths  consensus
quality of assemblies mouse
Quality of assemblies—mouse

Terminology:N50 contig length

If we sort contigs from largest to smallest, and start

Covering the genome in that order, N50 is the length

Of the contig that just covers the 50th percentile.

7.7X

sequence

coverage

quality of assemblies dog
Quality of assemblies—dog

7.5X

sequence

coverage

quality of assemblies chimp
Quality of assemblies—chimp

3.6X

sequence

Coverage

Assisted

Assembly

history of wga
History of WGA

1997

  • 1982: -virus, 48,502 bp
  • 1995: h-influenzae, 1 Mbp
  • 2000: fly, 100 Mbp
  • 2001 – present
    • human (3Gbp), mouse (2.5Gbp), rat*, chicken, dog, chimpanzee, several fungal genomes

Let’s sequence the human genome with the shotgun strategy

That is impossible, and a bad idea anyway

Phil Green

Gene Myers

slide19

$985 deCODEme

(November 2007)

$399 Personal Genome Service

(November 2007)

$2,500 Health Compass service

(April 2008)

Genetic Information Nondiscrimination Act

(May 2008)

$350,000 Whole-genome sequencing

(November 2007)

slide20

Applications

Whole-genome sequencing

Comparative genomics

Genome resequencing

Structural variation analysis

Polymorphism discovery

Metagenomics

Environmental sequencing

Gene expression profiling

Genotyping

Population genetics

Migration studies

Ancestry inference

Relationship inference

Genetic screening

Drug targeting

Forensics

slide21

New sequencing applications

Sequencing applications

Increase in sequencing data output

Demand for more sequencing

Sequencing technology improvement

slide22

Sequencing technology

Sanger sequencing

$10.00

$1.00

Cost per finished bp:

$0.10

$0.01

1975

1980

1990

2000

2008

Fred Sanger

Read length:

15 – 200 bp

500 – 1,000 bp

Throughput:

“grad-student years”

2 ∙ 106 bp/day

slide23

Sequencing technology

Sanger sequencing

3 ∙ 109 bp

1x coverage

10x coverage

× 3 ∙ 109 bp

= 40 years

2 ∙ 106 bp/day

= $30 million

10x coverage × 3 ∙ 109 bp × $0.001/bp

pyrosequencing on a chip
Pyrosequencing on a chip
  • Mostafa Ronaghi, Stanford Genome Technologies Center
  • 454 Life Sciences
slide25

Sequencing technology

Next-generation sequencing

“short reads”

Read length:

250 bp

Throughput:

300 Mb/day

Cost:

~ 10,000 bp/$

De novo:

yes

Genome Sequencer / FLX

slide28

Sequencing technology

Next-generation sequencing

Genome Analyzer

SOLiD Analyzer

“microreads”

Read length:

~ 35 bp

Throughput:

300 – 500 Mb/day

Cost:

~ 100,000 bp/$

De novo:

yes

slide31

Sequencing technology

Next-generation sequencing

“SNP chips”

Infinium Assay

GeneChip Array

genotypes

Read length:

1bp

Throughput:

1 – 2 Mb/day

Cost:

5,000 bp/$

De novo:

no

nanopore sequencing
Nanopore Sequencing

http://www.mcb.harvard.edu/branton/index.htm

slide33

Sequencing technology

Next-generation sequencing

ad