1 / 34

Biotechnology Toolbox for Synthetic Biology

Basic Molecular Biology and Genetics. Biotechnology Toolbox for Synthetic Biology. Presenter: Damon Tighe. Outline:. History of biology and biotechnology (highly abbreviated) Crash Course in Molecular Biology Central Dogma of Molecular Biology DNA Replication, Transcription, Translation

farrah
Download Presentation

Biotechnology Toolbox for Synthetic Biology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Basic Molecular Biology and Genetics Biotechnology Toolbox for Synthetic Biology Presenter: Damon Tighe

  2. Outline: • History of biology and biotechnology (highly abbreviated) • Crash Course in Molecular Biology • Central Dogma of Molecular Biology • DNA • Replication, Transcription, Translation • Protein • Basic Tools of Biotechnology • DNA Extraction (Lab) • Restriction Enzymes • Electrophoresis/Chromatography • PCR • DNA Sequencing • Synthetically building DNA • Protein technologies • Tying them all together - Insulin 15 min break

  3. History of biology and biotechnology (highly abbreviated) Sumerian Beer Recipe Thales of Melitus Aristotle 3000BC 624-546BC 384-322BC Kyui and Kimchi Father of Biology Father of Philosophy 6000BC Olive Press fortune Categorical –Observation Wine in Armenia Ethics 6000BC Battle of Halys Teleology

  4. History of biology and biotechnology (highly abbreviated) Birth of Microbiology Molecular Biology Natural Selection ~1650s – 1850s ~1850s – 1900s ~1900s – 1950s Charles Darwin Fridrich Miescher Anton van Leeuwenhoek Frederick Griffith et al. Louis Pasteur Alfred Russel Wallace Robert Koch Gregor Mendel Watson, Crick, Franklin

  5. History of biology and biotechnology (highly abbreviated) PCR Human Genome Project Semi-Synthetic Life 1983 2010 1990-2003 Kary Mullis Ari Patrinos Craig Venter Francis Collins Synthetic Genome used to re-boot/reprogram an existing cell Target and amplify specific regions of DNA Craig Venter

  6. Central Dogma of Molecular Biology Flow of information

  7. DNA macromolecule of information

  8. DNA DNA Structure/function Structure/function - -

  9. DNA Structure/function – Eukaryotic packing

  10. DNA Replication 5’ to 3’

  11. Figure 10.6 Transcription of a Eukaryotic Gene (Part 2) DNA -> RNA

  12. RNA Structure/function mRNA – messenger RNA 5’cap polyA tRNA – transfer RNA

  13. DNA Transcription and Translation The Protein Code ( Translation of RNA to Amino Acids)

  14. DNA Transcription and Translation

  15. Protein Structure/function

  16. Protein Structure/function Sickle Cell Anemia Single nucleotide mutation changes protein code, changes protein shape and function

  17. Protein Protein function function Form defines Function: Enzymes – catalyze reactions by lowering activation energy Structural- collagen, keratin, etc Storage – act as a reservoir of amino acids – ovalalbumin Antibodies – immune system ability to pin point antigens Hormones – signaling molecules that travel long distance in the body Contractile – myosin, muscle fibers

  18. Protein Enzymatic Pathways Carbs, fats, proteins

  19. DNA Technology – Extraction/Isolation Scale to fit your application Ethanol Extraction – quick/crude, damaged DNA, but can work with it Phenol-Chloroform – laborious, but high quality DNA Animation of Fugu Fish Extraction Spin Columns – quick and easy, use resin to isolate DNA

  20. DNA Technology - Extraction 2ml

  21. DNA Technology – Restriction Enzymes Endonucleases Restriction site Palindrome

  22. DNA Technology - Chromatography

  23. DNA Technology - Amplification Polymerase Chain Reaction (PCR) PCR Animation

  24. DNA Technology - Cloning Restriction Enzyme PCR Product

  25. DNA Technology - Sequencing Capillary Electrophoresis Illumina – highly parallel Ion Torrent

  26. DNA Technology - Sequencing Pacific Biosciences Oxford Nanopore

  27. Protein Technology – Production Price Per Gram Prices in US Dollars * As of 4/4/2012

  28. Protein Technology – Production Production is constrained by the organism we use to produce the protein in. We are constrained in part by the choices of history and the momentum of technology.

  29. Protein Technology – Chromatography • Ion Exchange (protein charge) • Size Exclusion (separates on size) • Hydrophobic Interaction (hydrophobicity) • Affinity: • Protein A  tail of Antibodies • His-tagged metal complexes (Ni) • Glutathione-s-transferase  glutathione

  30. DNA -> Protein -> consumer product Insulin – protein used to treat Diabetes Melitus Thales of Melitus Eli Lilly (Indianapolis) Genentech Olive Oil Insulin Insulin

  31. DNA -> Protein -> consumer product Extract DNA Clone into plasmid PCR Insulin Transform E.coli Grow E.coli Induce E.coli Selective pressure Harvest E.coli Proteins Purify Insulin via Chromatography

  32. DNA Technology – Chemical DNA Synthesis ligase ligase oligonucleotide

  33. Synthetic Biology GGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGC

More Related