Egenskaber ved sorter af v rbyg til kologisk dyrkning bar of
Download
1 / 13

Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF - PowerPoint PPT Presentation


  • 85 Views
  • Uploaded on
  • Presentation posted in: General

Sortsblandinger. Ukrudt. Sortsforsøg. Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF. Sygdomskomplekser. Matemati k og statistik. Mole kylære markører. N æringsstofoptagelse. Sortsblandinger. Ukrudt. Sortsforsøg.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha

Download Presentation

Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Sortsblandinger

Ukrudt

Sortsforsøg

Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF

Sygdomskomplekser

Matematik og statistik

Molekylære markører

Næringsstofoptagelse


Sortsblandinger

Ukrudt

Sortsforsøg

Egenskaber ved sorter af vårbygtil økologisk dyrkning – BAR-OF

Sygdomskomplekser

Matematik og statistik

Molekylære markører

Næringsstofoptagelse


Hvorfor DNA markører i BAR-OF?

  • Til at beskrive genetisk diversitet mellem linierne/sorterne

  • Til at sammenligne molekylære markører og morfologiske egenskaber til sortsbestemmelse

  • Til at beskrive forandringer i sammensætning af sortsblandinger gennem forsøgstidsrummet

  • Til at lokalisere gener for egenskaber med betydning i økologisk landbrug på kromosomfragmenter


Eksempel:

TGTGGGGCCACAAAACGTATAGATCAAAGTAATAATAATATTGATTAAATG

ATATATATATATATATATATATATATATATATATAT

CTAGAAGTTGTAGAAGACTAGCTAGAACGTACG

Hvilke DNA markører bliver brugt?

  • Mikrosatelliter= SSR (Simple Sequence Repeats)


Detektering af polymorfier

ACn


Fordeling af markørgrupper

96 liniermed 75 mikrosatelliter


Genetisk distance

MDS baseret på 96 byg-linier og 75 mikrosatelliter


Genetisk distance

MDS baseret på 96 byg-linier og 75 mikrosatelliter


Sammenligning med afstandfra morfologiske egenskaber


Brug af data i andre sammenhænge


Genspecifikke primer(2 forskellige farver)

Tst + Std

Std

+ CEL I

Eco-TILLING procedure

Pooling

DNAisolation

Standard(Std)

Tester(Tst)

PCR reaktion

Denaturering

Renaturering


Diskrimination af Mla-allelergennem Eco-TILLING


Stamtavle af Adonis med mlo

mlo9

mlo11


ad
  • Login