Egenskaber ved sorter af v rbyg til kologisk dyrkning bar of
This presentation is the property of its rightful owner.
Sponsored Links
1 / 13

Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF PowerPoint PPT Presentation


  • 63 Views
  • Uploaded on
  • Presentation posted in: General

Sortsblandinger. Ukrudt. Sortsforsøg. Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF. Sygdomskomplekser. Matemati k og statistik. Mole kylære markører. N æringsstofoptagelse. Sortsblandinger. Ukrudt. Sortsforsøg.

Download Presentation

Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Egenskaber ved sorter af v rbyg til kologisk dyrkning bar of

Sortsblandinger

Ukrudt

Sortsforsøg

Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF

Sygdomskomplekser

Matematik og statistik

Molekylære markører

Næringsstofoptagelse


Egenskaber ved sorter af v rbyg til kologisk dyrkning bar of1

Sortsblandinger

Ukrudt

Sortsforsøg

Egenskaber ved sorter af vårbygtil økologisk dyrkning – BAR-OF

Sygdomskomplekser

Matematik og statistik

Molekylære markører

Næringsstofoptagelse


Hvorfor dna mark rer i bar of

Hvorfor DNA markører i BAR-OF?

  • Til at beskrive genetisk diversitet mellem linierne/sorterne

  • Til at sammenligne molekylære markører og morfologiske egenskaber til sortsbestemmelse

  • Til at beskrive forandringer i sammensætning af sortsblandinger gennem forsøgstidsrummet

  • Til at lokalisere gener for egenskaber med betydning i økologisk landbrug på kromosomfragmenter


Hvilke dna mark rer bliver brugt

Eksempel:

TGTGGGGCCACAAAACGTATAGATCAAAGTAATAATAATATTGATTAAATG

ATATATATATATATATATATATATATATATATATAT

CTAGAAGTTGTAGAAGACTAGCTAGAACGTACG

Hvilke DNA markører bliver brugt?

  • Mikrosatelliter= SSR (Simple Sequence Repeats)


Detektering af polymorfier

Detektering af polymorfier

ACn


Fordeling af mark rgrupper

Fordeling af markørgrupper

96 liniermed 75 mikrosatelliter


Genetisk distance

Genetisk distance

MDS baseret på 96 byg-linier og 75 mikrosatelliter


Genetisk distance1

Genetisk distance

MDS baseret på 96 byg-linier og 75 mikrosatelliter


Sammenligning med afstand fra morfologiske egenskaber

Sammenligning med afstandfra morfologiske egenskaber


Brug af data i andre sammenh nge

Brug af data i andre sammenhænge


Eco tilling procedure

Genspecifikke primer(2 forskellige farver)

Tst + Std

Std

+ CEL I

Eco-TILLING procedure

Pooling

DNAisolation

Standard(Std)

Tester(Tst)

PCR reaktion

Denaturering

Renaturering


Diskrimination af mla alleler gennem eco tilling

Diskrimination af Mla-allelergennem Eco-TILLING


Stamtavle af adonis med mlo

Stamtavle af Adonis med mlo

mlo9

mlo11


  • Login