Egenskaber ved sorter af v rbyg til kologisk dyrkning bar of
Download
1 / 13

Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF - PowerPoint PPT Presentation


  • 98 Views
  • Uploaded on

Sortsblandinger. Ukrudt. Sortsforsøg. Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF. Sygdomskomplekser. Matemati k og statistik. Mole kylære markører. N æringsstofoptagelse. Sortsblandinger. Ukrudt. Sortsforsøg.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF' - fai


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Egenskaber ved sorter af v rbyg til kologisk dyrkning bar of

Sortsblandinger

Ukrudt

Sortsforsøg

Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF

Sygdomskomplekser

Matematik og statistik

Molekylære markører

Næringsstofoptagelse


Egenskaber ved sorter af v rbyg til kologisk dyrkning bar of1

Sortsblandinger

Ukrudt

Sortsforsøg

Egenskaber ved sorter af vårbygtil økologisk dyrkning – BAR-OF

Sygdomskomplekser

Matematik og statistik

Molekylære markører

Næringsstofoptagelse


Hvorfor dna mark rer i bar of
Hvorfor DNA markører i BAR-OF?

  • Til at beskrive genetisk diversitet mellem linierne/sorterne

  • Til at sammenligne molekylære markører og morfologiske egenskaber til sortsbestemmelse

  • Til at beskrive forandringer i sammensætning af sortsblandinger gennem forsøgstidsrummet

  • Til at lokalisere gener for egenskaber med betydning i økologisk landbrug på kromosomfragmenter


Hvilke dna mark rer bliver brugt

Eksempel:

TGTGGGGCCACAAAACGTATAGATCAAAGTAATAATAATATTGATTAAATG

ATATATATATATATATATATATATATATATATATAT

CTAGAAGTTGTAGAAGACTAGCTAGAACGTACG

Hvilke DNA markører bliver brugt?

  • Mikrosatelliter= SSR (Simple Sequence Repeats)



Fordeling af mark rgrupper
Fordeling af markørgrupper

96 liniermed 75 mikrosatelliter


Genetisk distance
Genetisk distance

MDS baseret på 96 byg-linier og 75 mikrosatelliter


Genetisk distance1
Genetisk distance

MDS baseret på 96 byg-linier og 75 mikrosatelliter


Sammenligning med afstand fra morfologiske egenskaber
Sammenligning med afstandfra morfologiske egenskaber



Eco tilling procedure

Genspecifikke primer(2 forskellige farver)

Tst + Std

Std

+ CEL I

Eco-TILLING procedure

Pooling

DNAisolation

Standard(Std)

Tester(Tst)

PCR reaktion

Denaturering

Renaturering


Diskrimination af mla alleler gennem eco tilling
Diskrimination af Mla-allelergennem Eco-TILLING



ad