DIY Molecular Cloning I
Download
1 / 33

DIY Molecular Cloning I : DNA Overview, Extracting DNA, - PowerPoint PPT Presentation


  • 157 Views
  • Uploaded on

DIY Molecular Cloning I : DNA Overview, Extracting DNA, Finding genetic sequences, Designing a cloning strategy. C. Rouskey Jan.2014. Intros. ...name and background, what you hope to learn... Me GETit. Outline. DNA Structure and Function/DNA Extraction

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' DIY Molecular Cloning I : DNA Overview, Extracting DNA,' - eudora


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

DIY Molecular Cloning I:

DNA Overview, Extracting DNA,

Finding genetic sequences, Designing a cloning strategy

C. Rouskey

Jan.2014


Intros

  • ...name and background, what you hope to learn...

  • Me

  • GETit


Outline

  • DNA Structure and Function/DNA Extraction

  • Sequences on the Web/Determining your GOI

  • Choosing a plasmid

    • Components (OriC, Promoter, Reporters, GOI)

  • Designing a cloning Strategy

    • Cloning System? Eukaryotic or Prokaryotic

  • Cloning

  • GETit Cloning Work



DNA Basics

  • Deoxyribonucleic Acid

    • Stores information

    • Made up of nucleotides

      • Adenine (p), Cytosine (py), Thymine (py), Guanine (p) with a deoxyribose backbone; RNA T = U(racil)

      • These nucleotides bind in complement to each other via hydrogen bonds (G:::C; A::T(U))

        • Hydrogen bonds are fairly weak when taken on their own, but the cumulative forces of these bonds make DNA stable

    • 5' and 3' ends

      • Two strands running in the opposite direction

      • Sequences are reverse complement


What kind of DNA?

  • Prokaryotic or Eukaryotic

    • Genomic

    • Plasmid


DNA Replication

Where does it occur?

How does it occur (overview)?

Major enzyme?

What are the results?


DNA Transcription

Where does it occur?

How does it occur? Promoter, ATG

What are the results?



DNA Translation

Where does it occur?

How does it occur? Ribosomes/tRNA, Start/Stop Codons

What are the

Results?

PROTEINS


Overview: Cloning with REs

What is molecular cloning?

tools used to create recombinant DNA molecules

General steps:

Amplify (via PCR) gene with RE sequences present

Digest PCR product and plasmid/Purify

Ligate PCR product into Plasmid

Transform E. coli – look at expression or purify plasmid


Molecular Biologist Toolkit

Genetic Databases – resource for sequences

Online analysis tools – primer design, restriction assessment

DNA/RNA – the genetic starting material

Plasmids – functional holding place for gene

Primers – directs DNA amplification, targets specific genes

Enzymes – used in the amplification cutting and ligation of DNA.

Host Strains – amplify and express your GOI


Online resources

Gene search: http://www.pubmed.com

Restriction analysis: http://tools.neb.com/NEBcutter2

Primer assessment: http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/

Composite program: Serial Cloner

Online Resources


Plasmids
Plasmids

Autonomously reproducing circular DNA

Origin of replication determines copy number (OriC)

Careful not to create a bio-burden on your cells


Plasmids1
Plasmids

Promoter - drives the transcription of GOI

Multiple cloning Site – Space to pop in GOI downstream of promoter

Reporters – let you assess if GOI is being expressed

Purification Tags – helpful in downstream purification of proteins (useful tool for functional protein studies


Primers
Primers

Strands of DNA that serve as the starting point for DNA synthesis


Host strains
Host Strains

E. coli is the basic cloning host for growing plasmid and expressing prokaryotic proteins.

E. coli can be used to propagate plasmid containing eukaryotic genes but expression is not really useful (post-translational modifications present in Euks)

Competent cells! E. cloni 10G (super easy), Can make your own competent cells

After plasmid is made, pop it into E. coli



Quick GETit background

Bacteriophage therapy

Lytic vs. Lysogenic Phage

(for more info visit http://getitproject.org/getit-project-meetup-112313/


Cloning (GETit)

1. Find the genetic sequences of interest

http://www.pubmed.com

a. are there phage in the N. gonorrhoeae genome?


Cloning Strategy

Find a plasmid that you can clone into:

What are you trying to accomplish?

What kind of gene is it?

What do you want to do with the genetic material?

Order plasmid from addgene (http://addgene.com)

We want a moderate copy number, promoter, antibiotic resistance gene


Goi phage tail protein i 187aa

5'-TCACACTGCACAGCCCCGCTGCCGACATCGAATGCGGCAACGGCGAATACATCCGAATCACGTCCACGCTCGAGCGCGAATAAATGAACAGCACCGTCCCCGCGAACAACAGCCCCCTGCAACACGCACTGGCAAAGCTGACAGAACGCGAAACTGCCGCCGTCTCCCGCCAACTCGACCCCGCCCGATGCGACCCCGGATTTTTACCCTTTCACGCCTTCGCAAGAAGCATCGGCACGGAAGAGGGCTGGGACTTTGCCGAAACCGACGAAGCCCGCCGCAACCTCATCGCAGGCTTTGCCGAAATCCACGCCCGAAAAGGCACGCCGTACGCCATCCGCGCCCTCTTCCCCATCTTGCGGCTGGGCGAAATCCAAATTATCGAACGCGACGGCGAGTTCAAGTGGGACGGCTCGGTCTTGTTCGACGGCAGCCGCACATTCGGCAGGCGCGAGGGTGACTGGGCGGAATACCGCATTGTCTTAACGCGCCCCGTCAGCATCCGCCAAACCGCCCGCATCCGCGCCATGTTGGCGGAAATCGCCCCCTTGCGGTGCGAACTTACCGCGCTCGACTACCGCAACCATCCCCACCGCTGGAACGGCAAAATCCGCTTTAACGGCGAATACGGTTTCGGCACGACATAACGCGCCCCCGAAAATCAACAAACAAAAGGAAGCCCCAAAATGGCAAACGCAACCGAACAAAACCAATTCGACCAAGCCGTCCGCC-3'

GOI: phage tail protein I (187aa)


Enzymes
Enzymes

DNA Polymerase (used to amplify template)

Restriction endonucleases cut at specific sites

Ligase


Deciding where to clone?

1. I like BamHI and EcoRV (can I cut them together?)

http://66.155.211.155/nebecomm/DoubleDigestCalculator.asp

BamHI EcoRV

2. Analyze Gene Sequence

- Are there restriction sites internally?

http://tools.neb.com/NEBcutter2/!


Primer Design

1. Determine Primer sequence for PCR...

5' end...

Sequence: 5' -TCACACTGCACAGCCCCGCTGCCGACATCGAATGCGGCAA

Primer: 5' - CCGCTGCCGGATCCGAATG

3' end...

Sequence: 5' - AAAACCAATTCGACCAAGCCGTCCGCC – 3'

3' - TTTTGGTTAAGCTGGTTCGGCAGGCGG – 5'

Primer: 3' - TTTTGGTTGATATCGTTCGGCAGGCGG – 5'

5' - GGCGGACGGCTTGCTATAGTTGGTTTT – 3'


DNA Sequence 5' – TCACACTGCACAGCCCCGCTGCCGACATCGAATG -3'

Primer 5' - CCGCTGCCGGATCCGAATG

Complement

3' - AGTGTGA....

Reverse Complement

5' – CATTCGAT....



Restriction Digest

Set up a restriction digest reaction using BamHI and EcoRV

Digest Plasmid and PCR product

Analyze digest on gel




Sequencing confirm protein protein expression analysis via page protein purification

Sequencing (confirm protein)

Protein Expression/Analysis via PAGE

Protein Purification

Downstream Applications


Experiment

1. Find the genetic sequence

http://banana-genome.cirad.fr/musa

2. Design primers

3. Extract DNA from Musa acuminata...(Protocol)

4. PCR


ad