Genetic Engineering - PowerPoint PPT Presentation

Genetic Engineering
Download
1 / 44

Genetic Engineering. Topics. Concepts. Agrobacterium Gene gun Protoplasts Anti-sense technology. DNA code is universal Plants can be transformed with “foreign” DNA using one of several methods Antisense technology can eliminate a trait Successful genetic engineering

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha

Download Presentationdownload

Genetic Engineering

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Slide1 l.jpg

Genetic Engineering

Topics

Concepts

  • Agrobacterium

  • Gene gun

  • Protoplasts

  • Anti-sense technology

  • DNA code is universal

  • Plants can be transformed

  • with “foreign” DNA using one

  • of several methods

  • Antisense technology can

  • eliminate a trait

  • Successful genetic engineering

  • depends on a plant’s offspring

  • carrying the new gene

Terms

  • Cloning

  • Agrobacterium

  • Plant hormones

  • Callus


Slide2 l.jpg

Damage done by Lepidoptera

Corn borer

Gypsy Moths

Monarch Butterflies

Cabbage Butterflies


Slide3 l.jpg

Bacillus thuringiensis is an effective biocontrol agent

Intact bacteria

Spore

Bt-toxin

helios.bto.ed.ac.uk/ bto/microbes/bt.htm


Slide4 l.jpg

Scientists have used genetic engineering to move

the Bt-gene into plants


Cloning l.jpg

CLONING

  • Cutting and splicing genes

  • Generating an exact copy

    • Cells

    • Organism (i.e potato)


Cloning 2 definitions l.jpg

CLONING: 2 definitions

  • Cutting and splicing genes

  • Generating an exact copy

    - cells

    - organism (i.e. potato)


Moving the bt gene into plants l.jpg

Moving the Bt-gene into plants


Slide8 l.jpg

In nature, Agrobacterium carries a

Tumor-inducing (Ti) plasmid

Genomic DNA

Ti-plasmid

(tumor-inducing)

Agrobacterium


Slide9 l.jpg

The Ti-plasmid carries Transfer DNA (T-DNA)

T-DNA

Plant

promoter

Plant hormone

genes

Opine

Synthesis genes


Slide10 l.jpg

Agrobacterium delivers the Transfer DNA (T-DNA)

to the plant cell

Agrobacterium

Plant Cell


Slide11 l.jpg

The Transfer DNA (T-DNA) integrates into

to the plant DNA

Agrobacterium

Plant Cell


Slide12 l.jpg

The Transfer DNA (T-DNA) integrates into

to the plant DNA

Plant

promoter

Plant hormone

and opine

Synthesis genes

Plant Cell


Slide13 l.jpg

Agrobacterium forces plant to become a opine factory

http://helios.bto.ed.ac.uk


Slide14 l.jpg

In genetic engineering, scientists highjack

the Ti-plasmid and clone the Bt-toxin gene into it

Ti-plasmid

Plant promoter

Bt-toxin gene

T-DNA


Slide15 l.jpg

The Transfer DNA (T-DNA) integrates into

to the plant DNA

T-DNA + Bt-toxin gene

Agrobacterium

Plant Cell


Goal to get your gene of interest into every cell of a plant l.jpg

Goal: To get your gene of interest into every cell of a plant

If you want to sell your genetically modified seed –

EVERY seed needs

to have the “new” gene


3 ways to get your gene into every plant cell l.jpg

3 ways to get your gene into every plant cell

  • Use Agrobacterium to transform the gametes of a plant, then grow a plant from the seeds after pollination.

  • Use Agrobacterium to transform plantprotoplasts, then regenerate plants from those cells.

  • Use gene gun to transform plantcells, then regenerate plants from those cells.


Genetically engineering plants floral dip l.jpg

Genetically engineering plants: floral dip

Flowers

Dip flowers in a

solution of

Agrobacterium

(with your gene plus

herbicide-

resistance gene)


Slide19 l.jpg

Agrobacterium can move into pistil and specifically

transform the ovules (gametes)

Bent lab, U. of Wisconsin


Transforming plants floral dip l.jpg

Transforming plants: floral dip

Flowers

Dip flowers in a

solution of

Agrobacterium

(with your gene plus

herbicide-

resistance gene)

Seeds growing

on herbicide:

only seeds with

herb.-resistance

can grow

Seed pods

Bent lab, U. of Wisconsin


Slide21 l.jpg

Only Seedlings with T-DNA integrated

into their own DNA can survive in presence of herbicide

EH, U. of Wisconsin

Success Rate = 1/ 3000


Slide22 l.jpg

Floral dip transformation has only

been successful for a few plants (dicots)


3 ways to get your gene into every plant cell23 l.jpg

3 ways to get your gene into every plant cell

  • Use Agrobacterium to transform the gametes of a plant, then grow a plant from the seeds after pollination.

  • Use Agrobacterium to transform plantprotoplasts, then regenerate plants from those cells.

  • Use gene gun to transform plantcells, then regenerate plants from those cells.


Slide24 l.jpg

Piece of Potato Leaves

J. Helgeson, UW-Madison


Slide25 l.jpg

Protoplasts Released from Leaves (cell walls stripped)

See 541-542 in Life


Slide26 l.jpg

Transform protoplasts with Agrobacterium

T-DNA (engineered withgene of interest plus herbicide-resistance gene)

Agrobacterium cell


Slide27 l.jpg

  • Grow protoplasts in a plant medium that contains:

  • Plant hormones (to stimulate cell division and differentiation)

  • Herbicide (to prevent non-engineered cells from growing)


Slide28 l.jpg

Clumps of plant cells grow (called callus).

Only cells with herbicide-resistance gene will grow.


Slide29 l.jpg

New plant will grow from callus


Slide30 l.jpg

New plant will grow from callus


Slide31 l.jpg

New plant will grow from callus

… and every cell will contain your gene of interest...


Slide32 l.jpg

…including the gametes which will provide the gene to the next generation.


3 ways to get your gene into every plant cell33 l.jpg

3 ways to get your gene into every plant cell

  • Use Agrobacterium to transform the gametes of a plant

  • Use Agrobacterium to transform plant protoplasts (stem cells) and regenrate plants from those cells

  • Use gene gun to transform plant cells and regenerate plants from those cells


Slide35 l.jpg

Transform plant cells directly with gene gun

(especially monocots)

Plant cell

Gold beads covered with DNA

from your gene of interest + herbicide-resistance gene


Slide36 l.jpg

Gene gun


Slide37 l.jpg

The gene gun can be used to shoot callus.

Then regenerate a plant from transformed callus tissue.

(Grow it in a medium with plant hormones & herbicide.)


Slide38 l.jpg

Steps in Genetic Engineering

Step 1: Isolate your gene of interest.

Step 2: Clone into a Ti-plasmid:your gene of interest plus an herbicide-resistance gene.

Step 3: Transform your plant the altered Ti-plasmid.

Step 4: Regenerate entire plant from transformed cells, callus, or seeds.


Slide39 l.jpg

Subtracting a trait: Flavor Savor Tomato


Slide40 l.jpg

Softening is due to destruction of pectin

Pectin: Cell rigidity

PG

Polygalacturonase


Slide41 l.jpg

Softening is due to destruction of pectin

Pectin: Cell rigidity

PG

Polygalacturonase


Slide42 l.jpg

Antisense Technology:

How to prevent PG enzyme from being made

SENSE

ANTISENSE

P

TATATACGAAGGCAC……

ATATATGCTTCCGTG……

TACGAAGGCAC..TATA

ATGCTTCCGTG…ATAT

P

AUGCUUCCGUG

UACGAAGGCAC…

AUGCUUCCGUGUACGAAGGCAC

Double stranded RNA cannot be translated because

it binds with antisense mRNA.


Slide43 l.jpg

Antisense Technology

Tomato plants carrying the antisense PG gene showed

95% reduction in PG enzyme.

These Flavr-Savr tomatoes ripened on the vine but stayed

firm for a longer period of time.


Issues in genetic engineering l.jpg

Issues in Genetic Engineering

What are the impacts of genetic engineering?

  • Biological or environmental

  • Socio-economic

  • Political or legislative


ad
  • Login