Faculdade de medicina de s o jos do rio preto novas tecnologias de biologia molecular no c ncer
This presentation is the property of its rightful owner.
Sponsored Links
1 / 15

FACULDADE DE MEDICINA DE SÃO JOSÉ DO RIO PRETO Novas tecnologias de biologia molecular no câncer PowerPoint PPT Presentation


  • 56 Views
  • Uploaded on
  • Presentation posted in: General

FACULDADE DE MEDICINA DE SÃO JOSÉ DO RIO PRETO Novas tecnologias de biologia molecular no câncer. MicroRNAs: nova classe de reguladores gênicos envolvidos na função endócrina e câncer. Filho J.C.M Ricarte, Kimura E. Teruko, Arq Bras Endocr Metabol, vol 50, n 6, Dez 2006. Rodrigo Nunes Cal

Download Presentation

FACULDADE DE MEDICINA DE SÃO JOSÉ DO RIO PRETO Novas tecnologias de biologia molecular no câncer

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Faculdade de medicina de s o jos do rio preto novas tecnologias de biologia molecular no c ncer

FACULDADE DE MEDICINA DE SÃO JOSÉ DO RIO PRETONovas tecnologias de biologia molecular no câncer

MicroRNAs: nova classe de reguladores gênicos envolvidos na função endócrina e câncer

Filho J.C.M Ricarte, Kimura E. Teruko, Arq Bras Endocr Metabol, vol 50, n 6, Dez 2006

Rodrigo Nunes Cal

Marcelo Bandeira Fernandes


Microrna mirna

MicroRNA / miRNA

  • Moléculas de RNA fita simples de 19-25 nucleotídeos

  • Não codificadores de proteínas

  • Potentes reguladores pós-transcricionais

  • Lin4 (lineage-deficient-4) descoberto em 1993, no Caenorhabditis elegans


Faculdade de medicina de s o jos do rio preto novas tecnologias de biologia molecular no c ncer

  • Estudos de bioinformática estimam que há mais de 1000 miRNAs em humanos.

  • Os miRNAs possuem seqüências pequenas e agem sem a necessidade de pareamento completo, por isso, um único miRNA pode regular muitos RNAm-alvo, além de cooperarem no controle de um único RNAm.

  • Grande parte de seus genes está alinhada no genoma, formando nichos denominados de cluster. Neste caso, um grupo de genes forma um único transcrito primário que originará diversos microRNAs maduros após processamento.


Biog nese dos micrornas

Biogênese dos microRNAs

1- Transcrição do seu gene pela RNA polimerase II miRNA primário contendo cap5´ e cauda poli(A).

2- Processamento do pri-miRNA pela enzima RNase III (Drosha) e seu cofator DGCR8.

3- Formação do pré-miRNA e transferência para o citoplasma pela exportina-5, que utiliza o RanGTP como co-fator.

4- Processamento do pré-miRNA pela RNase III (Dicer), gerando um miRNA fita dupla.

5- Incorporação do miRNA a um complexo multimérico RISC.

6- Uma das fitas do duplex de miRNA é degradada enquanto a outra permanece no complexo RISC para controlar a expressão pós-transcricional de genes-alvo.


Caracteriza o biol gica d e mirna s

Dicer (RNAase III)

Caracterização biológica de miRNAs

Loop

UGAGGUAGUAGGUUGUAUAGU

(miRNA)


Mecanismos regulat rios dos mirnas

Mecanismos regulatórios dos miRNAs

  • Degradação do RNAm: ligação por complementaridade perfeita ou quase perfeita ao RNAm-alvo, degrandando-o através de ribonucleases no complexo miRISC (silenciamento genético).

  • Inibição traducional: ligação por complementaridade imperfeita em regiões 3´ não traduzidas do RNAm, inibindo a expressão gênica de maneira pós-transcricional.


Inibi o traducional

miRNA

Interrupção

miRNA

Inibição traducional


Mirnas e a fun o end crina

miRNAs e a função endócrina

  • O miR-375 regula a secreção da insulina em células β do pâncreas de camundongo e inibe a expressão da miotrofina (proteína que induz a exocitose de grânulos de insulina).

  • O miR-124 e o let-7b atuam em conjunto com o miR-375 no controle da expressão da miotrofina. Outros 67 miRNAs já foram identificados em células β. Atualmente não se sabe se ocorrem alterações na função dos miRNAs em pacientes diabéticos.

  • A melhor caracterização do papel dos miRNAs nos mecanismos de secreção de insulina poderá levar à compreensão da fisiopatologia do diabetes, além de auxiliar no desenvolvimento de novos tratamentos.


Faculdade de medicina de s o jos do rio preto novas tecnologias de biologia molecular no c ncer

  • A deleção do miR-14 em Drosophila melanogaster está associada com o aumento do tamanho da gota do adipócito e o maior acúmulo do triacilglicerol.

  • O miR-143 está associado à diferenciação de adipócitos e a redução dos seus níveis in vitro em pré-adipócitos humanos promove a diminuição da expressão de genes específicos das células adipócitas, além de diminuir sua habilidade em acumular triglicérides.

  • Poucos miRNAs foram associados com o funcionamento endócrino; no entanto, muitos genes importantes neste sistema são alvos potenciais dos miRNAs.


Mirna e c ncer

miRNA e Câncer

  • 50% dos genes de miRNAs estão localizados em sítios genômicos associados ao câncer.

  • Podem atuar como oncogene ou gene supressor tumoral


Faculdade de medicina de s o jos do rio preto novas tecnologias de biologia molecular no c ncer

  • miRNAs que atuam como genes supressores tumorais

  • miR-15 e o miR-16

  • Localização de seus genes: cromossomo 13q14 (uma região deletada em mais da metade das leucemias linfocíticas crônicas de células B).

  • Uma mutação germinativa no lócus gênico de miR-15/miR-16 diminuiu a expressão destes miRNAs em células de LLC.

  • Menor expressão em adenomas hipofisiários, sendo esta expressão inversamente correlacionada com o tamanho do tumor.

  • Regulação negativa da expressão do oncogene anti-apoptótico BCL2 que se apresenta superexpresso em diversos cânceres humanos.


Faculdade de medicina de s o jos do rio preto novas tecnologias de biologia molecular no c ncer

  • Os níveis dos miRNAs de miR-143 e miR-145 estão diminuídos em tumores colorretais e linhagens celulares de câncer linfóide, mama, próstata e colo uterino.

  • Os miRNAs pertencentes à família let-7 também estão inseridos no grupo de miRNAs supressores tumorais, regulando negativamente a expressão das isoformas do oncogene RAS.

  • Estudos in vitro utilizando linhagem celular de adenoma de pulmão humano mostra que a superexpressão de let-7 apresenta efeito inibitório na proliferação celular destas células, indicando que o mesmo seja um agente terapêutico promissor no tratamento de câncer causado pela ativação de RAS.


Faculdade de medicina de s o jos do rio preto novas tecnologias de biologia molecular no c ncer

  • miRNAs que exercem ação oncogênica

  • O miR-155 apresenta expressão aumentada em linfomas e células de câncer de mama.

  • A análise da expressão global de miRNAs em carcinoma papilífero da tiróide revelou um grande aumento na expressão de três miRNAs: miR-221, miR-222 e miR-146.

  • O miR-21 apresenta expressão aumentada em tumores de mama e glioblastoma e o knockout deste miRNA em cultura de células de glioblastoma leva à indução de apoptose.


Faculdade de medicina de s o jos do rio preto novas tecnologias de biologia molecular no c ncer

  • Um cluster de miRNAs designado miR-17-92, compreendendo os miRNAs miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-19b-1 e miR-92-1, tem sido considerado potencialmente oncogênico.

  • A introdução do miR-17-92 intensifica a proliferação das células de câncer de pulmão.

  • Em um modelo de camundongos transgênicos, a expressão do cluster miR-17-92 adicionada à expressão do oncogene MYC induziu a progressão de linfomas de células B.

  • Os alvos preditos para o cluster miR-17-92 incluem os genes supressores de tumor PTEN, associados com a Síndrome de Cowden, e RB2, membro da família da proteína Retinoblastoma.


Faculdade de medicina de s o jos do rio preto novas tecnologias de biologia molecular no c ncer

  • O padrão de expressão de miRNAs por microarray em câncer humano pode ser utilizado eficientemente na classificação tumoral.

  • Num painel de mais de 200 cânceres humanos, dados de expressão de 217 miRNAs foram mais eficientes na definição do tipo de câncer do que 16.000 RNAs, indicando que o perfil de expressão de miRNA poderá ter extrema utilidade no diagnóstico de câncer.

  • Observou-se de forma global a diminuição da expressão dos miRNAs em tumores, sugerindo que a maioria dos miRNAs representem supressores tumorais.

  • O desafio atual é identificar os alvos que estão regulados pelos miRNAs. Estudos apontam que um único complexo miRISC pode se ligar à mais de 200 genes-alvo, e estes alvos podem ter funções diversas. Portanto, os miRNAs controlam a expressão de cerca de 1/3 do RNAm humano, e a deleção ou alteração na expressão pode contribuir para diversas doenças, incluindo o câncer.


  • Login