90 likes | 172 Views
Answers to Biotech Jeopardy. Biotechnology Test Review Questions: Easy Small, circular piece of bacterial DNA is called a ____. Give two examples of vectors: The entire collection of genes within human cells is called the _______________. Difference between technology and biotechnology?
E N D
Biotechnology Test Review Questions: • Easy • Small, circular piece of bacterial DNA is called a ____. • Give two examples of vectors: • The entire collection of genes within human cells is called the _______________. • Difference between technology and biotechnology? • Function of restriction enzymes? • HGP stands for? How many base pairs in HG? How many proteins? • Difference between surrogate and biological mother? • A _____________ is caused by a defective or mutant gene. • Define gene. • The first cell created by sexual reproduction is called a
Biotechnology Test Review Questions: • Easy • Small, circular piece of bacterial DNA is called a ____. • Give two examples of vectors: • The entire collection of genes within human cells is called the _______________. • Difference between technology and biotechnology? • Function of restriction enzymes? • HGP stands for? How many base pairs in HG? How many proteins? • Difference between surrogate and biological mother? • A _____________ is caused by a defective or mutant gene. • Define gene. • The first cell created by sexual reproduction is called a
Medium • 1. Inserting unrelated pieces of DNA together will result in ____________________. • 2. IVF stands for? What is a synonym used for IVF? • 3. What does transgenic mean? • 4. Identical twins are considered to be genetic ___________. • 5. How does IVF work? What does the female have to do? What does the male have to do? • 6. Why does IVF sometimes result in twins, triplets, or quads? • 7. Difference between fraternal vs. identical twins? • 8. How does Gel Electrophoresis separate DNA fragments? • 9. What is an example of a genetic disease? • 10. What kind of ethical questions arise from IVF?
Medium • 1. Inserting unrelated pieces of DNA together will result in ____________________. • 2. IVF stands for? What is a synonym used for IVF? • 3. What does transgenic mean? • 4. Identical twins are considered to be genetic ___________. • 5. How does IVF work? What does the female have to do? What does the male have to do? • 6. Why does IVF sometimes result in twins, triplets, or quads? • 7. Difference between fraternal vs. identical twins? • 8. How does Gel Electrophoresis separate DNA fragments? • 9. What is an example of a genetic disease? • 10. What kind of ethical questions arise from IVF?
Disease Huntington’s disease, sickle cell anemia, cystic fibrosis • Ethical questions • Will anyone be harmed? • What will be done with the extra embryos? • Who will pay the cost? • Do all involved parties agree? • Is it safe for the mother and embryo?
Difficult • What is the difference between gene therapy and genetic engineering? • Difference between a hybrid and chimera? • Steps of genetic engineering? • The Hind R1 restriction enzyme is used to slice DNA at the GAATTC between the G and C. Illustrate how this enzyme would precisely cut the fragment: • ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA • TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT • What research can be done using gel electrophoresis?
Difficult • What is the difference between gene therapy and genetic engineering? • Difference between a hybrid and chimera? • Steps of genetic engineering? • The Hind R1 restriction enzyme is used to slice DNA at the GAATTC between the G and C. Illustrate how this enzyme would precisely cut the fragment: • ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA • TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT • What research can be done using gel electrophoresis?
Hybrid has DNA from 2 organism in each cell • Chimera has cells from different organisms in the body