Massively Parallel Signature Sequencing (MPSS)
This presentation is the property of its rightful owner.
Sponsored Links
1 / 18

Massively Parallel Signature Sequencing (MPSS) PowerPoint PPT Presentation


  • 537 Views
  • Uploaded on
  • Presentation posted in: General

Massively Parallel Signature Sequencing (MPSS). Attachment of cDNA to microbeads via unique tags. AAAAAAAAA. mRNA from biological samples. x. AAAAAAAAA TTTTTTTTTT. cDNA. Unique tags (16.7M). (20 base). Unique complementary Anti-tag. PCR. attached.

Download Presentation

Massively Parallel Signature Sequencing (MPSS)

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Massively parallel signature sequencing mpss

Massively Parallel Signature Sequencing (MPSS)


Massively parallel signature sequencing mpss

Attachment of cDNA to microbeads via unique tags

AAAAAAAAA

mRNA from biological samples

x

AAAAAAAAA

TTTTTTTTTT

cDNA

Unique tags (16.7M)

(20 base)

Unique complementary Anti-tag

PCR

attached

Result: cDNA derived from each mRNA molecule a single microbead


Massively parallel signature sequencing mpss

Micro-Bead Monolayer


Massively parallel signature sequencing mpss

Parallel signature sequencing

NNNN

NNNN

4321

NNNN

Determine the overhang -NNNN with sequencing cycles

NNNN

NNNN

8765

NNNN

Signature: NNNN…NNNN, known sequences of 20 bases


Massively parallel signature sequencing mpss

Determine the overhang -NNNN with sequencing cycles

e.g. N at position 1

Fluorescence-labeled decoder for nucleotide

Fluorescence-labeled decoder for nucleotide

Fluorescence-labeled decoder for nucleotide

Fluorescence-labeled decoder for nucleotide

G

A

T

C

Call for base at position 1

G


Massively parallel signature sequencing mpss

Track the positions of microbeads

and

capture the fluorescence intensity for each decoder (G, A, T,C)

at each base position


Massively parallel signature sequencing mpss

NNNN

NNNN

4321

NNNN

NNNN

NNNN

4321

NNNN

NNNN

NNNN

4321

NNNN


Massively parallel signature sequencing mpss

(75,179)

G

(188,358)

G

1

(75,179)

(188,358)


Massively parallel signature sequencing mpss

(75,179)

G

A

(188,358)

G

A

1

2

(75,179)

(188,358)


Massively parallel signature sequencing mpss

(75,179)

G

A

T

(188,358)

G

A

T

1

2

3

(75,179)

(188,358)


Massively parallel signature sequencing mpss

G

A

T

C

(75,179)

G

A

T

C

(188,358)

1

2

3

4

(75,179)

(188,358)


Massively parallel signature sequencing mpss

^

NNNN

CODE

RS

NNNN

^

4 3 2 1

9

Digest with Type IIs enzyme to expose next 4 bases

13

NNNN

8 7 6 5

Repeat Cycle

Stepping in Four Bases


Massively parallel signature sequencing mpss

G

A

T

C

(75,179)

G

A

T

C

T

(188,358)

G

1

2

3

4

5

(75,179)

(188,358)


Massively parallel signature sequencing mpss

G

A

T

C

HUMFTE1A

G

A

T

C

T

T

A

C

C

C

G

T

G

A

C

A

A

A

A

T

HSRNPA1

G

T

G

A

C

G

C

T

G

A

A

T

A

A

A

T

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

(75,179)

(188,358)


Massively parallel signature sequencing mpss

Sequencing a Specific Bead Address

G A T C C C A G T G A A T C C T G G G T


Massively parallel signature sequencing mpss

Signature

# of Beads

1

GATCTGCATTCGGTAACAGG

1

2

GATCTTTGTCAACCAAAACA

2

3

GATCCCTGTGAAGACCCAGG

113

4

GATCTTTCCTCCTGGTTACT

16

5

GATCCAGTCAAGGAGAAAGA

3

6

GATCTGATAGTCCTGAAAAC

22

7

GATCATGGTGATGTACGGGG

1

8

GATCCAGTGCTATTCTGTCA

38

9

GATCAATCCCTCAAGATTTT

312

.

.

23,685

GATCACCATCCCAGTCACCT

2,588

856,567


  • Login