Real time pcr
Download
1 / 13

REAL-TIME PCR - PowerPoint PPT Presentation


  • 168 Views
  • Uploaded on

REAL-TIME PCR. APPLICATION PRINCIPLE INSTRUMENTATION INSTRUCTOR: EDDIE WAMPANDE. Roche lightcycler 480. Application of LC. Instrumentation Plate holder LED lamp CCD camera Computer— process the data- EXO. Absolute quantification of Nucleic acid Melting curve (SNP analysis) Tm

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' REAL-TIME PCR' - edith


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Real time pcr

REAL-TIME PCR

APPLICATION

PRINCIPLE

INSTRUMENTATION

INSTRUCTOR: EDDIE WAMPANDE


Rochelightcycler480

Application of LC

  • Instrumentation

  • Plate holder

  • LED lamp

  • CCD camera

  • Computer—process the data- EXO

  • Absolute quantification of Nucleic acid

  • Melting curve (SNP analysis) Tm

  • Gene scanning

Requirements

IXO files

  • Primers

  • Probes (flourecsently labeled)

    • 640 red dye


Types of probes
Types of probes

  • Taqman probes

  • Hydrolysis probes

  • Hybridization probes……………..



Distinguishing mtb uganda genotype from other genotypes using snp assays

Showing the SNPs

Distinguishing MTB Uganda genotype from other genotypes using SNP assays

Hershberg et al, 2008


Principle of genotyping using hybridization probes

  • Probes designed to identify wild type (non-Uganda genotype, no SNP leads to perfect match).

  • Uganda genotype Presence of SNP, there is a mismatch.


  >Rv004c (DNA) unknown function

  • ATGATCCAGATCGCGCGCACCTGGCGGGTCTTCGCAGGCGGCATGGCCACCGGTTTCATCGGCGTGGTGCTGGTCACCGCCGGGAAGGCCTCAGCGGATCCCCTGCTGCCACCGCCGCCTATCCCTGCCCCAGTCTCGGCGCCGGCAACAGTCCCGCCCGTGCAGAACCTCACGGCGCTTCCGGGCGGGAGCAGCAACAGGTTCTCACCGGCGCCAGCACCCGCACCGATCGCGTCGCCGATTCCGGTCGGAGCACCCGGGTCCACCGCTGTGCCCCCGCTGCCGCCGCCAGTGACTCCCGCGATCAGCGGCACACTTCGGGACCACCTCCGGGAGAAGGGCGTCAAGCTGGAGGCACAGCGACCGCACGGATTCAAGGCGCTCGACATCACACTGCCCATGCCGCCGCGCTGGACTCAGGTGCCCGACCCCAACGTGCCCGACGCGTTCGTGGTGATCGCCGACCGGTTGGGCAACAGCGTCTACACGTCGAATGCGCAGCTGGTGGTGTATAGGCTGATCGGTGACTTCGATCCCGCTGAGGCCATCACACACGGCTACATTGACAGCCAGAAATTGCTCGCATGGCAGACCACAAACGCCTCGATGGCCAATTTCGACGGCTTTCCGTCATCAATCATCGAGGGCACCTACCGCGAAAACGACATGACCCTCAACACCTCCCGGCGCCACGTCATCGCCACCTCCGGAGCCGACAAGTACCTGGTTTCGCTGTCGGTGACCACCGCGCTGTCGCAGGCGGTCACCGACGGGCCGGCCACCGATGCGATTGTCAACGGATTCCAAGTGGTTGCGCATGCGGCGCCCGCTCAGGCGCCTGCCCCGGCACCCGGTTCGGCACCGGTGGGACTACCCGGGCAGGCGCCTGGGTATCCGCCCGCGGGCACCCTGACACCAGTCCCGCCGCGCTAG  

  • Forward primer

  • ATT GCT CGC ATG GCA GA

  • Reverse primer

  • AAA CCA GGT ACT TGT CGG

  • Probe 1

  • LC Red 640 -TGA TGA CGG AAA GCC GTC GAA A-Phosphate

  • Probe 2

  • GTT TTC GCG GTA GGT GCC CTC GAT G-Fluorescein

  • Condition for designing primer/probes

    • As for primers

    • Size of amplicon.. (100-300 bp)

    • Distance between probes (2bp)

    • 3’- is phosphrylated

    • The dye is put at the 5’ end


Procedure in the lightcycler
Procedure in the Lightcycler

  • Extracted genomic DNA by heating the MTB in PCR water followed by centrifugation.

  • Make many copies of the target region by PCR.

  • Allow the probes to hybridize, Melting curve step and observe for the melting temperature .

    • High Tm= wild type.

    • Lower Tm= Uganda genotype.


Genotyping mtb by snp analysis
Genotyping MTB by SNP analysis

  • Mix the reagents as for PCR and include the probes

    Steps

    • Amplification– Normal PCR say 35 cycles

    • Melting curves (to allow the probes hybridize onto the amplicon & later melt off)

      • The difference in Melting temperature will determine the presence of SNP

        • High Tm, due to perfect match= Wild type, No SNP (non-Uganda genotype)

        • Lower Tm, because of mismatch= Mutant, presence of SNP (Uganda genotype)



ad