real time pcr
Download
Skip this Video
Download Presentation
REAL-TIME PCR

Loading in 2 Seconds...

play fullscreen
1 / 13

REAL-TIME PCR - PowerPoint PPT Presentation


  • 169 Views
  • Uploaded on

REAL-TIME PCR. APPLICATION PRINCIPLE INSTRUMENTATION INSTRUCTOR: EDDIE WAMPANDE. Roche lightcycler 480. Application of LC. Instrumentation Plate holder LED lamp CCD camera Computer— process the data- EXO. Absolute quantification of Nucleic acid Melting curve (SNP analysis) Tm

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' REAL-TIME PCR' - edith


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
real time pcr

REAL-TIME PCR

APPLICATION

PRINCIPLE

INSTRUMENTATION

INSTRUCTOR: EDDIE WAMPANDE

slide2

Rochelightcycler480

Application of LC

  • Instrumentation
  • Plate holder
  • LED lamp
  • CCD camera
  • Computer—process the data- EXO
  • Absolute quantification of Nucleic acid
  • Melting curve (SNP analysis) Tm
  • Gene scanning

Requirements

IXO files

  • Primers
  • Probes (flourecsently labeled)
    • 640 red dye
types of probes
Types of probes
  • Taqman probes
  • Hydrolysis probes
  • Hybridization probes……………..
slide8

Principle of genotyping using hybridization probes

  • Probes designed to identify wild type (non-Uganda genotype, no SNP leads to perfect match).
  • Uganda genotype Presence of SNP, there is a mismatch.
slide9

  >Rv004c (DNA) unknown function

  • ATGATCCAGATCGCGCGCACCTGGCGGGTCTTCGCAGGCGGCATGGCCACCGGTTTCATCGGCGTGGTGCTGGTCACCGCCGGGAAGGCCTCAGCGGATCCCCTGCTGCCACCGCCGCCTATCCCTGCCCCAGTCTCGGCGCCGGCAACAGTCCCGCCCGTGCAGAACCTCACGGCGCTTCCGGGCGGGAGCAGCAACAGGTTCTCACCGGCGCCAGCACCCGCACCGATCGCGTCGCCGATTCCGGTCGGAGCACCCGGGTCCACCGCTGTGCCCCCGCTGCCGCCGCCAGTGACTCCCGCGATCAGCGGCACACTTCGGGACCACCTCCGGGAGAAGGGCGTCAAGCTGGAGGCACAGCGACCGCACGGATTCAAGGCGCTCGACATCACACTGCCCATGCCGCCGCGCTGGACTCAGGTGCCCGACCCCAACGTGCCCGACGCGTTCGTGGTGATCGCCGACCGGTTGGGCAACAGCGTCTACACGTCGAATGCGCAGCTGGTGGTGTATAGGCTGATCGGTGACTTCGATCCCGCTGAGGCCATCACACACGGCTACATTGACAGCCAGAAATTGCTCGCATGGCAGACCACAAACGCCTCGATGGCCAATTTCGACGGCTTTCCGTCATCAATCATCGAGGGCACCTACCGCGAAAACGACATGACCCTCAACACCTCCCGGCGCCACGTCATCGCCACCTCCGGAGCCGACAAGTACCTGGTTTCGCTGTCGGTGACCACCGCGCTGTCGCAGGCGGTCACCGACGGGCCGGCCACCGATGCGATTGTCAACGGATTCCAAGTGGTTGCGCATGCGGCGCCCGCTCAGGCGCCTGCCCCGGCACCCGGTTCGGCACCGGTGGGACTACCCGGGCAGGCGCCTGGGTATCCGCCCGCGGGCACCCTGACACCAGTCCCGCCGCGCTAG  
  • Forward primer
  • ATT GCT CGC ATG GCA GA
  • Reverse primer
  • AAA CCA GGT ACT TGT CGG
  • Probe 1
  • LC Red 640 -TGA TGA CGG AAA GCC GTC GAA A-Phosphate
  • Probe 2
  • GTT TTC GCG GTA GGT GCC CTC GAT G-Fluorescein
  • Condition for designing primer/probes
    • As for primers
    • Size of amplicon.. (100-300 bp)
    • Distance between probes (2bp)
    • 3’- is phosphrylated
    • The dye is put at the 5’ end
procedure in the lightcycler
Procedure in the Lightcycler
  • Extracted genomic DNA by heating the MTB in PCR water followed by centrifugation.
  • Make many copies of the target region by PCR.
  • Allow the probes to hybridize, Melting curve step and observe for the melting temperature .
    • High Tm= wild type.
    • Lower Tm= Uganda genotype.
genotyping mtb by snp analysis
Genotyping MTB by SNP analysis
  • Mix the reagents as for PCR and include the probes

Steps

    • Amplification– Normal PCR say 35 cycles
    • Melting curves (to allow the probes hybridize onto the amplicon & later melt off)
      • The difference in Melting temperature will determine the presence of SNP
        • High Tm, due to perfect match= Wild type, No SNP (non-Uganda genotype)
        • Lower Tm, because of mismatch= Mutant, presence of SNP (Uganda genotype)
ad