slide1
Download
Skip this Video
Download Presentation
Advancements in the understanding of genetic factors in problem gambling

Loading in 2 Seconds...

play fullscreen
1 / 37

Advancements in the understanding of genetic factors in problem gambling - PowerPoint PPT Presentation


  • 159 Views
  • Uploaded on

Advancements in the understanding of genetic factors in problem gambling. Daniela S. S. Lobo, MD, PhD Neurogenetics Section Centre for Addiction and Mental Health. Supported by the Ontario Problem Gambling Research Centre -OPGRC, and the State of São Paulo Research Funding Agency – FAPESP. .

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Advancements in the understanding of genetic factors in problem gambling' - eamon


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Advancements in the understanding of genetic factors in problem gambling

Daniela S. S. Lobo, MD, PhD

Neurogenetics Section

Centre for Addiction and Mental Health

Supported by the Ontario Problem Gambling Research Centre -OPGRC, and the State of São Paulo Research Funding Agency – FAPESP.

problem and pathological gambling
Problem and Pathological Gambling
  • Problem Gamblers (PrG) experience problems with gambling in a less severe degree compared to Pathological Gamblers (PtG).
  • Prevalence in adults (Shaffer et al., 2001; Stucki & Rihs-Middel, 2007):
  • PrG: up to 4%
  • PtG: 0.5 – 2%
slide3

1/3 PtG are females* (Volberg, 1994; Boughton & Falenchuk, 2007)

Gender differences: gambling style

different gambling activities

“gambling to escape feelings of guilt and depression”

more rapid progression

slide4

Comorbidity of Pathological Gambling

PG

Bipolar

Spectrum

ADHD

Other

Impulse Control

Disorders

Mood Disorders

Personality

Disorders

Suicide

Compulsive

Sexual Behaviors

Substance Use

Disorders

(Potenza, 2002)

genetic studies and pg
Genetic Studies and PG:
  • Family Studies:
  • Gambino et al. (1993): risk 12 x for subjects whose parents / grandparents were pathological gamblers.
  • Habra et al. (1995), Gupta e Derevensky (1997) Ibañez et al. (2003): association with familial factors.
  • Black et al. (2005): of 8.3% for PG and 12.4% for any gambling disorder among FDR of PG. Significantly higher when compared to FDR of a control group (2.1% for PG and 3.5% for any gambling disorder). Higher comorbidity with mood disorders in FDR of PG.
twin studies
Twin Studies:
  • Winters e Rich (1999): 92 twin pairs – male and high action games
  • No evaluation of problem/ pathological gambling.
  • Eisen et al. (1998); Slutske et al. (2000); Potenza et al. (2005):
  • 3359 twin pairs, DZ – 9.8% / MZ – 22.6%
  • Heritability of 46% for the 4 + symptoms of PG.
  • Shared vulnerability : PtG and Alcohol Dependence,
  • Anti-social Personality and Major Depressive Disorder*
what can genes do
WHAT CAN GENES DO?

Genes from the “Mendelian Ages”….

1 gene can fully account for 1 “observable” characteristic

GENOTYPE PHENOTYPE

slide11

GENE VARIANTS (alleles, polymorphisms)

CAATGCTTACCGGATCACATAGATATA

SNP (Single Nucleotide Polymorphism):

CAATGCTTACCGGATCACATAGATATA

CAATGCTCACCGGATCACATAGATATA

VNTR (Variable Number of Tandem Repeats):

CAATGCTTACCGGATCACATAGATATA

CAATGCTTACCGGACCGGATCACATAGATATA

CAATGCTTACCGGACCGGACCGGATCACATAGATATA

CAATGCTTACCGGACCGGACCGGACCGGATCACATAGATATA

what can genes do13
WHAT CAN GENES DO?

Genes in the “Computer Age”

large increase in genetic information
Large Increase in Genetic Information:
  • DNA chip with 1,000,000 markers now available to genetic researchers
  • Normal statistics will produce 5% false positive tests, thus 50,000 positive results!
  • How can we know what markers of the 50,000 are truly linked to the disease?
  • Need guidance from clinical and neurobiological information.
addictions immediate reward
Addictions Immediate Reward

Reward System- Olds and Milner, 1954

ventral tegmental area, n. accumbens, frontal cortex

DOPAMINE (DA) - Accumbens

Unpredictable reward – greater dopamine release – behavior maintenance

DA PATHWAY

slide17

PtG

Controls

Diff.

Increased activation

DLPF cortex in PG

p<0.05

Biol Psychiatry 2005; 58:787-795

slide18

TH

phenylalanine

dopamine

BDNF

DAT

MAO-A

COMT

DRD1

DRD2

DRD3

DRD4

DRD5

other genes…

slide21

Methods:

  • PG seeking treatment
  • 140 sib-pairs interviewed: PG and one non-gambler sibling, age difference below 5 years.
  • Pathological Gambling diagnosis: DSM-IV and SOGS
  • Temperament and Character Inventory - TCI (Cloninger,1993) and Barrat Impulsiveness Scale - BIS (Patton and Barrat, 1995).
  • Psychiatric Comorbidity: SCAN.
dopamine d1 receptor gene markers

Prom1

Dopamine D1 Receptor Gene Markers

-800 A/G

-48 C/T

+1403 A/G

Prom2

Coding Region

rs26596 G/T

slide23

DRD1 -800 T/C

SNP (Single Nucleotide Polymorphism):

CAATGCTTACCGGATCACATAGATATA

CAATGCTAACCGGATCACATAGATATA

CAATGCTGACCGGATCACATAGATATA

PROMOTER TIMING, AMOUNT

slide25

CAMH Problem Gambling Study

  • DSM-IV for problem gambling (self-report version)
  • South Oaks Gambling Screen (SOGS)
  • The Random Events Knowledge Test
  • Gambling Cognition Questionnaire (GCQ)
  • The Temperament and Character Inventory (TCI)
  • Stopsignal Paradigm Test (SSPT)
  • The Wender Utah Rating Scale (WURS) for ADHD
  • ALBERTA COHORT STUDY
mao a gene x chromosome
MAO –A GENE – X chromosome

Exon 8

rs6323

Intron 11

Rs979606

Intron 12

rs979605

Intron 3

rs909525

Promoter

VNTR

Intron 9

rs 3027399

Intron 2

rs5906957

Exon 14

rs1801291

Intron 10

Rs 2205758

slide27

MAO-A VNTR

VNTR (variable number of tandem repeats):

CAATGCTTACCGGATCACATAGATATA

CAATGCTTACCGGATCACATAGATATA

CAATGCTTACCGGACCGGATCACATAGATATA

CAATGCTTACCGGACCGGACCGGATCACATAGATATA

CAATGCTTACCGGACCGGACCGGACCGGATCACATAGATATA

PROMOTER TIMING, AMOUNT

mao a vntr
MAO-A VNTR

130 female PtG x 124 female controls

slide29
BDNF

rs7103411

rs11030104

HinfI

val66met

rs2049045

bdnf val66met
BDNF val66met

CAATGCTTACCGGATCACATAGATATA

CAATGCTTACCGGATCACATAGATATA

CAATGCTTACCAGATCACATAGATATA

Change a part of the protein

Alteration in protein structure

bdnf val66met31
BDNF val66met

177 male PtG x 97 male controls

slide33

Alberta Cohort Study

N ~ 1000 subjects

Identification of individuals at-risk

Follow up after 5 years

Assessment of gambling behaviour

slide34

46%

Genetic

vulnerability

Genes’ variants

PG

+

Life-events

Exposure to gambling

Winning experiences

(Turner et al.,2002)

54%

Environment +

Random factors

slide35

TH

phenylalanine

dopamine

BDNF

DAT

MAO-A

COMT

DRD1

DRD2

DRD3

DRD4

DRD5

slide36

What can we do?

  • Integration of knowledge from different fields
  • Vulnerability models and prevention strategies
  • Discovery of new drugs for treatment of PG
slide37

THANKS!

Neurogenetics Laboratory - CAMH

Dr. James Kennedy

Nicole King

Sahar Ehtesham

Joanne Brathwaite

Olga Likohdi

Institute of Psychiatry – University of São Paulo

PROGENE – Psychiatric Genetic Laboratory

AMJO – Gambling Outpatient Unit

ad