Avian influenza diagnostic techniques
Download
1 / 19

Avian influenza diagnostic techniques - PowerPoint PPT Presentation


  • 252 Views
  • Uploaded on

Avian influenza diagnostic techniques. Saliha Hammoumi CIRAD Montpellier, France. AI laboratory diagnosis. Serological diagnosis Useful for epidemiological surveillance or to supplement virological diagnosis Virological diagnosis

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Avian influenza diagnostic techniques' - durin


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Avian influenza diagnostic techniques

Avian influenza diagnostic techniques

Saliha Hammoumi

CIRAD Montpellier, France


Ai laboratory diagnosis
AI laboratory diagnosis

  • Serological diagnosis

    • Useful for epidemiological surveillance or to supplement virological diagnosis

  • Virological diagnosis

    • Detection of the virus responsible of the disease, or its genes or antigenes

    • Necessitate early sampling after first symptoms

    • Samples: Tracheal or cloacal swabs, organs (dead birds)


Serological diagnosis
Serological diagnosis

  • Antibody detection

    • Agar gel immunodiffusion (AGID)

    • Enzyme Linked ImmunoSorbent Assay (ELISA)

    • Haemagglutination Inhibition Assay (HIA)


Agar gel immunodiffusion agid

Antigen

+ control

Test Serum

Agar gel immunodiffusion (AGID)

  • detection of antibody directed against NP and M1

  • good specificity

  • Sensitivity depends on the species

  • Can be use with all bird species


Enzyme linked immunosorbent assay elisa
Enzyme Linked ImmunoSorbent Assay (ELISA)

  • Commercial kits available for chicken and turkey

  • Detection of antibody directed against NP

  • ELISA indirect

  • Good sensitivity

  • Rapid results


Haemagglutination inhibition assay hia
Haemagglutination Inhibition Assay (HIA)

  • Reference antigen necessary

  • Red blood cells (RBC) from AIV and NDV free chicken

  • Serum is positive when the reference antigen does not haemagglutinate red blood cells

+

+

RBC

Reference antigen

Diluted test serum

Serum dilution

1/4096

1/2

+ serum : 1/1024

HA+

HA-


Virological diagnosis
Virological diagnosis

  • Detection of virus, its genes or antigens

    • Detection of antigen by ELISA

    • Detection of viral RNA by RT-PCR

    • Detection of infectious virus by isolation on embryonated chicken eggs


Detection of antigen
Detection of antigen

  • Enzyme Linked Immuno-Sorbent Assay (ELISA)

    • Samples to be kept at 4°C

    • Commercial kits: Directigen Flu A + B Kit – Becton Dickinson Microbiology Systems

      • Rapid results (about 15 min)

      • False negative possible if there is

        bacterial contamination


Detection of viral rna
Detection of viral RNA

  • Samples

    • Tracheal or cloacal swabs in transport medium

    • Organs (dead birds)

    • Conservation at low temperature : +4°C for few days or -80°C, dry ice, liquid nitrogen

  • Process samples in BSL2 or 3

  • Specific material required

    • Thermocycler for qualitative RT-PCR

    • And/or Real-time PCR machine


Detection of viral RNA

  • RNA extraction from samples (manual or automatic)

  • Detection of type A influenza:

    • Matrix (M) gene by (real-time) RT-PCR

  • Detection of H5 or H7 subtypes by (real-time) RT-PCR on AIV A positive samples

  • RT-PCR on the cleavage site of HA for H5 or H7 positive samples

  • Sequencing of the amplified cleavage site for determination of pathogenicity


M+25

M-124

Detection of type A influenza: real-time RT-PCR specific of M gene

Taqman Technology

Primers Spackman: M+25/M-124

Probe M+64 FAM-BHQ1

Q-RT-PCR OIE protocole

M+25

M-124

M+64

M gene


Detection of type a influenza conventional rt pcr specific of m gene

Amplicon of 601pb

M2

M1

M-AIVsens (H5N2) (230) ACTGCAGCGTAGACGCTTTGTCCAAAATGCCCTCAATGGGAATGGAGACC

IVAMM2E (H1N1) (234) ACTGCAGCGTAGACGCTTTGTCCAAAATGCCCTAAATGGGAATGGAGACC

AB036778 (H3N2) (244) ACTGCAGCGTAGACGCTTTGTCCAAAATGCCCTTAATGGGAACGGGGATC

NC_002016 (H1N1) (244) ACTGCAGCGTAGACGCTTTGTCCAAAATGCCCTTAATGGGAACGGGGATC

AY210255 (H1N1) (219) ACTGCAGCGTAGACGCTTTGTCCAAAATGCCCTCAATGGGAATGGGGATC

CY000794 (H3N2) (243) ACTGCAGCGTAGACGCTTTGTCCAAAATGCCCTCAATGGGAATGGGGATC

CY006188 (H1N2) (232) ACTGCAGCGTAGACGCTTTGTCCAAAATGCCCTTAATGGGAATGGGGATC

NC_004907 (H9N2) (251) ACTGCAGCGTAGACGATTTGTCCAAAATGCCCTAAATGGGAATGGAGACC

(H5N1)/segment 7) (244) ACTGCAGCGTAGACGATTTGTCCAAAATGCCCTAAATGGGAATGGAGACC

NC_007363 (H5N1) (244) ACTGCAGCGTAGACGCTTTGTCCAGAATGCCTTAAATGGAAATGGAGATC

AY627887 (H5N1) (242) ACTGCAGCGTAGACGCTTTGTCCAGAATGCCCTAAATGGAAATGGAGATC

AM040045 (H5N1) (226) ACTGCAGCGTAGACGCTTTGTCCAGAACGCCCTAAATGGAAATGGAGATC

AB239319 (H5N1) (223) ACTGCAGCGTAGACGCTTTGTCCAGAATGCCCTAAATGGAAATGGAGATC

AB239326 (H5N1) (220) ACTGCAGCGTAGACGCTTTGTCCAGAATGCCCTAAATGGAAATGGAGATC

DQ100569 (H5N1) (181) ACTGCAGCGTAGACGCTTTGTCCAGAATGCCCTAAATGGAAATGGAGATC

Consensus (251) ACTGCAGCGTAGACGCTTTGTCCAAAATGCCCTAAATGGGAATGGAGATC

(780) TGTTGCAGCAAGTATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTC

(784) TACTGCAGCAAGTATCATTGGGATCTTGCACCCGATATTGTGGATTCTTGATCGTC

(794) TATTGCCGCAAATATCATTGGGATCTTGCACTTGACATTGTGGATGCTTGATCGTC

(794) TATTGCCGCAAATATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTC

(769) TGTTGCTGCGAGTATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTC

(793) TGTTGCTGCGAGTATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTC

(782) TGTTGCTGCGAGTATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTC

(801) TGTTGCAGCAAGTATCATTGGGATATTGCACTTGATATTGTGGATTCTTGATCGTC

(794) TGTTGCCGCAAGTATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTC

(794) TGTTGCCGCAAGTATCATTGGGATACTGCACTTGATATTGTGGATTCTTGATCGTC

(792) TGTTGCCGCAAATATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTC

(775) --------------------------------------------------

(773) TGTTGCCGCAAGTATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTC

(770) TGTTGCCGCAAGTATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTC

(731) TGTTGCCGCAAGTATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTC

(801) TGTTGCCGCAAGTATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTC

Detection of type A influenza: conventional RT-PCR specific of M gene

  • Detection of the Matrix gene in a region conserved among the different influenza A subtypes: primer M1/M2 (E.Starick et al., 2000)

  • Suitable for Influenza detection in birds as well as pig, horse and human

M+25

M-124

M+64

M1

M2

M gene


Detection of H5 subtypes

  • Real-time RT-PCR

     Primers H5LH1 / H5RH1 (VLA, Weybridge, UK)

     Taqman probe H5PRO –5’(FAM ) /…/ (BHQ1)-3’

Probe

H5PRO

H5-Kha-1

H5-Kha-3

H5LH1

H5RH1

HA-875F

HA-1114R

J3

B2a

Site

de clivage

HA Gene

  • Conventional RT-PCR: primers H5 from VLA, Weybridge, UK

     HA-875F / HA-1114R

     J3 / B2a

     H5-Kha1 / H5-Kha3

Different sensitivity and specificity

Complementary

RT-PCR

Sequencing of the amplification product = pathotyping


Detection of H7 subtypes

  • Real-time RT-PCR

     Primers LH6H7 / RH4H7 (VLA, Weybridge, UK)

     Taqman probe H7pro11 –5’(FAM ) /…/ (BHQ1)-3’

Probe

H7pro11

GK 7.3 

GK 7.4

LH6H7

RH4H7

Site

de clivage

HA Gene

  • Conventional RT-PCR: primers H7 from VLA, Weybridge, UK

     Primer GK 7.3 / GK 7.4 

Sequencing of the amplification product = pathotyping


Detection of h5 or h7 subtypes
Detection of H5 or H7 subtypes

High variation of haemagglutinin gene

Necessary to verify the sequences of the circulating strains to design new primers so that false negative can be avoided

ex: design of H5 real-time RT-PCR primers by Spackman et al. (2002)

Observation of differences on HA gene between North American Strain and Eurasian strains

Modification of H5 primers used in Europe and Africa (Slomka et al. 2007)


Isolation in embryonated chicken eggs
Isolation in embryonated chicken eggs

  • Samples

    • Tracheal or cloacal swabs in transport medium

    • Organs (dead birds): heart, trachea, spleen, brain, liver

    • Conservation at low temperature : +4°C for few days or -80°C, dry ice, liquid nitrogen

  • Process samples in BSL2 or BSL3

  • Specific material required

    • Specific pathogen free eggs

    • Egg incubators


Isolation in embryonated chicken eggs1
Isolation in embryonated chicken eggs

  • Inoculation of sample in allantoic cavity of embryo of 9 to 11 days

  • Confirmation of isolation after 2 to 7 days of incubation at 37°C

    • Detection of haemagglutinating activity of allantoic fluid

    • Confirmation of the presence of Influenza A virus by Agar gel immunodiffusion test

    • Determination of the subtype by inhibition haemagglutination assay with specific antiserums


Alternative isolation methods
Alternative isolation methods

  • Isolation on primary chicken embryo fibroblasts

  • Isolation on Madine Darby Canine Kidney cells (MDCK)


Ai team in cirad montpellier
AI team in CIRAD Montpellier

  • Yane Kandassamy

  • Thierry Lefrançois

  • Frédéric Petitclerc

  • Saliha Hammoumi

  • Patricia Gil

  • Colette Grillet

  • Emmanuel Albina


ad