dna fingerprinting
Download
Skip this Video
Download Presentation
DNA Fingerprinting

Loading in 2 Seconds...

play fullscreen
1 / 32

DNA Fingerprinting - PowerPoint PPT Presentation


  • 167 Views
  • Uploaded on

PBG/MCB 620 DNA Fingerprinting. DNA Fingerprinting . A method for the detection of DNA variation. image source - http://db2.photoresearchers.com/feature/infocus1. Applications of DNA fingerprinting. Human genetics and disease Systematics and taxonomy

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' DNA Fingerprinting ' - dexter


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
dna fingerprinting

PBG/MCB 620 DNA Fingerprinting

DNA Fingerprinting

A method for the detection of DNA variation

image source - http://db2.photoresearchers.com/feature/infocus1

applications of dna fingerprinting
Applications of DNA fingerprinting
  • Human genetics and disease
  • Systematics and taxonomy
  • Population, quantitative, and evolutionary genetics
  • Plant and animal breeding and genetics
  • Legal, forensic, and anthropological analysis
  • Genome mapping and analysis
important timeline

Important Timeline

Discovery of DNA as the Hereditary Material in 1944

DNA structure described in 1953

Restriction endonucleases discovered in 1968-1969

DNA sequencing described in 1977

DNA fingerprinting first used in 1985

Polymerase chain reaction (PCR) invented in 1985

deoxyribonucleic acid dna structure
DeoxyriboNucleic Acid (DNA) structure

“It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material”

(Watson and Crick 1953)

slide5

DNA STRUCTURE

  • DNA is the hereditary material and contains all the information needed to build an organism.
  • It is a polymeric molecule made from discrete units called nucleotides.
  • Nucleotides link together to form a DNA strand at positions 3’ and 5’
  • Nitrogenous base:
  • Purines: Adenine and Guanine
  • Pyrimidines: Thymine and Cytosine

Sugar: 2-deoxyribose

Phosphate group

Nucleotide Thymidine

slide6

2 strands of polynucleotides:

  • Twisted around each other in clock-wise direction
  • Antiparallel: complementary and inverse
  • H-Bridges links that are specific:

G

C

A

T

slide7

The structure of DNA is identical in all eukaryotes, therefore the genetic information resides in the sequence of their bases

Gene is a DNA segment with a sequence of bases that has the information for a biologic function. Alternative forms of a gene are called alleles

slide8

WHERE IS THE DNA LOCATED IN EUKARYOTES?

  • A small fraction is located in the organelles:
    • Chloroplats (cpDNA): 135 to 160 kb with high density of genes
    • Mithocondria (mtDNA): 370 to 490 kb. Only about 10% are genes
    • Most of it in the nucleus:
    • 63 Mb to 150 Gb in plants; 20Mb to 130 Gb in animals
    • Number of molecules (chromosomes) highly variable: 2 to >500 in animals and 2 to >1000 in plants.
    • Just a very small fraction of the genome is actual genes.
    • Some tens of thousand genes and gene clusters are scatterd around in a vast majority of apparently non-functional DNA.
    • DNA is associated with other components (mainly proteins) and form a complex called Chromatin.

Nucleus

Mitochondria

Chloroplast

From Brooker et al. Genetics: Analysis & Principles. McGraw Hill. 2009

slide9

WHERE IS THE DNA LOCATED IN EUKARYOTES?

  • Chromatin:
  • The basic structure of chromatin is made of DNA and proteins (histones)
  • The structure of the chromatin changes throughout the cell cycle:
  • Most of the time, when the cell is not undergoing mitosis, the chromatin is relatively uncondensed. However, there are more compacted zones (heterochromatin) and less compacted zones (euchromatin, which is the majority).
  • When the cell is going to divide, the chromatin gets more and more compacted producing individualized structures called methaphasic chromosomes

From Brooker et al. Genetics: Analysis & Principles. McGraw Hill. 2009

slide10

DNA MUTATIONS

Changes in the nucleotide sequence of genomic DNA that can be transmitted to the descendants.

If these changes occur in the sequence of a gene, it is called a mutant allele. The most frequent allele is called the wild type.

A DNA sequence is polymorphic if there is variation among the individuals of the population.

slide11

DNA MUTATIONS

Types of mutations depending on the effect on the DNA sequence:

5’ – AgctgAactcgacctcgcgatccgtagttAgactag -3’

Wildtype

5’ – AgctgAactcggcctcgcgatccgtagttAgactag -3’

Substitution

(transition: A G

5’ – AgctCAactcgacctcgcgatccgtagttAGactag -3’

Substitution

(transversion: G C)

C

5’ – AgctAactcgacctcgcgatccgtagttAGactag -3’

Deletion

(single bp)

CAactcgacc

5’ – AgcttcgcgatccgtagttAGactag -3’

Deletion

(DNA segment)

slide12

DNA MUTATIONS

Types of mutations depending on the effect on the DNA sequence:

5’ – AgctgAactcgacctcgcgatccgtagttAgactag - 3’

Wildtype

5’ – AgctGAactAcgacctcgcgatccgtagttAGactag - 3’

Insertion

(single bp)

5’ – AgctGAactAGTCTGCCcgacctcgcgatccgtagttAGactag-3’

Insertion

(DNA segment)

5’ – AgcAGTTGAcgacctcgcgatccgtagttAGactag-3’

Inversion

Tranposition:

5’ – AgctcgacctcgcgatccgtagttAtgAacgactag- 3’

slide13

DNA MUTATIONS

Types of mutations depending on the effect on the protein:

5’ – AgctCAactcgacctcgcgatccgAagttAgactag- 3’

Wildtype

Arg

Ser

Ser

Leu

Asp

Lys

Asp

Thr

Arg

Pro

STOP

Pro

5’ – AgctCAactcgacctcgTgatccgAagttAgactag- 3’

Silent

Arg

Ser

Ser

Leu

Asp

Lys

Asp

Thr

Arg

Pro

STOP

Pro

5’ – AgctCAactcgacctTgcgatccgAagttAgactag- 3’

Amino acid change

Cys

Ser

Ser

Leu

Asp

Lys

Asp

Thr

Arg

Pro

STOP

Pro

A

5’ – AgctCAactcgcctcgcgatccgAagttAgactag- 3’

Frame shift

Ala

Ser

Ser

STOP

Ser

Ile

Thr

Arg

Leu

Arg

5’ – AgctCAactcgacctcgcgatccgTagttAgactag- 3’

STOP

Arg

Ser

Ser

Lys

Asp

Thr

Arg

Pro

Pro

slide14

REPLICATION

TRANSLATION

TRANSCRIPTION

RNA

DNA

PROTEINS

slide15

DNA REPLICATION

  • DNA primase: catalyzes the synthesis of a short RNA primer complementary to a single strand DNA template
  • Helicase: unwinds and separates the two strands of DNA
  • Gyrase: facilitates the action of the helicase relieving tension of the coiled DNA
  • Single Stranded DNA binding proteins (SSB): stabilize single strand DNA
  • DNA polymerase: synthesize a new DNA strand complementary to a template strand by adding nucleotides one at a time to a 3’ end.
slide16

POLYMERASE CHAIN REACTION – PCR

  • Invented by K.B Mullis in 1983
  • Allows in vitro amplification of ANY DNA sequence in large numbers
  • Design of two single stranded oligonucleotide primers complementary to motifs on the template DNA.
slide18

POLYMERASE CHAIN REACTION – PCR

  • Each cycle can be repeated multiple times if the 3’ end of the primer is facing the target amplicon. The reaction is typically repeated 25-50 cycles.
  • Each cycle generates exponential numbers of DNA fragments that are identical copies of the original DNA strand between the two binding sites.
  • The PCR reaction consists of:
    • A buffer
    • DNA polymerase (thermostable)
    • Deoxyrybonucleotidetriphospates(dNTPs)
    • Two primers (oligonucleotides)
    • Template DNA
    • And has the following steps:
      • Denaturing: raising the temperature to 94 C to make DNA single stranded
      • Annealing: lowering the temperature to 35 – 65 C the primers bind to the target sequences on the template DNA
      • Elongation: DNA polymerase extends the 3’ ends of the primer sequence. Temperature must be optimal for DNA polymerase activity.
slide21

1st cycle

2nd cycle

slide22

http://www.dnalc.org/resources/animations/pcr.html

  • http://learn.genetics.utah.edu/content/labs/pcr/

POLYMERASE CHAIN REACTION – Links:

3rd cycle

restriction endonucleases
Restriction Endonucleases
  • Enzymes which recognize a specific sequence of bases within double-stranded DNA.
  • Endonucleases make a double-stranded cut at the recognition site.
  • Examples:

EcoRI

5‘- G|AATTC

3‘- CTTAA|G

BamHI

5‘- G|GATCC 3‘- CCTAG|G

HindIII

5‘- A|AGCTT

3‘- TTCGA|A

slide24

A process used to separate DNA fragments

  • An electric current passes through agarose or polyacrylamide gels
  • The electrical current forces molecules to migrate into the gel at different rates depending on their sizes

From Hartwell et al. Genetics. McGraw Hill. 2008

slide25

Link: http://www.wellcome.ac.uk/Education-resources/Teaching-and-education/Animations/DNA/WTDV026689.htm

SANGER DNA SEQUENCING

  • Buffer
  • DNA polymerase
  • dNTPs
  • Labeled primer
  • Target DNA

ddATP

ddGTP

deoxinucleotyde (dNTP)

dideoxinucleotyde (ddNTP)

ddTTP

ddCTP

slide26

G

C

A

T

*TTAAGTACATACCTAGTACCACTATATAATG

*GCTTAAGTACATACCTAGTACCACTATATAATG

*TAAGTACATACCTAGTACCACTATATAATG

*GTACATACCTAGTACCACTATATAATG

*TACATACCTAGTACCACTATATAATG

*GTACCACTATATAATG

*TACCTAGTACCACTATATAATG

*TAGTACCACTATATAATG

*ACGCTTAAGTACATACCTAGTACCACTATATAATG

*CGCTTAAGTACATACCTAGTACCACTATATAATG

*AAGTACATACCTAGTACCACTATATAATG

*CATACCTAGTACCACTATATAATG

*AGTACATACCTAGTACCACTATATAATG

*CCTAGTACCACTATATAATG

Separate gel lanes

Single gel lane

*ATACCTAGTACCACTATATAATG

*CTAGTACCACTATATAATG

*ACCTAGTACCACTATATAATG

*AGTACCACTATATAATG

dna polymorphisms
DNA polymorphisms
  • Insertion-deletion length polymorphism – INDEL
  • Single nucleotide polymorphism – SNP
  • Simple sequence repeat length polymorphism – mini- and micro-satellites
slide28

Allele A

Allele a

a

a

A

a

A

a

a

A

Ind 5

Ind 1

Ind 3

Ind 4

Ind 2

Ind 8

Ind 6

Ind 7

slide29

Allele A

Allele a

a

a

A

a

A

a

a

A

Ind 5

Ind 1

Ind 3

Ind 4

Ind 2

Ind 8

Ind 6

Ind 7

restriction fragment length polymorphism rflp
Restriction Fragment Length Polymorphism (RFLP)
  • RFLPs (Botstein et al. 1980) are differences in restriction fragment lengths caused by a SNP or INDEL that create or abolish restriction endonuclease recognition sites.
  • RFLP assays are based on hybridization of a labeled DNA probe to a Southern blot (Southern 1975) of DNA digested with a restriction endonuclease

Labeled 3’ TGGCTAGCT 5’

Probe 3’ TGGCTAGCT 5’

|||||||||

Target 1 5’-CCTAACCGATCGACTGAC-3’ 2 5’-GGATTGGCTAGCTGACTG-3’

features of rflps
Features of RFLPs
  • Co-dominant
  • Locus-specific
  • Genes can be mapped directly
  • Supply of probes and markers is unlimited
  • Highly reproducible
  • Requires no special instrumentation
ad