Dna fingerprinting
This presentation is the property of its rightful owner.
Sponsored Links
1 / 32

DNA Fingerprinting PowerPoint PPT Presentation


  • 110 Views
  • Uploaded on
  • Presentation posted in: General

PBG/MCB 620 DNA Fingerprinting. DNA Fingerprinting . A method for the detection of DNA variation. image source - http://db2.photoresearchers.com/feature/infocus1. Applications of DNA fingerprinting. Human genetics and disease Systematics and taxonomy

Download Presentation

DNA Fingerprinting

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Dna fingerprinting

PBG/MCB 620 DNA Fingerprinting

DNA Fingerprinting

A method for the detection of DNA variation

image source - http://db2.photoresearchers.com/feature/infocus1


Applications of dna fingerprinting

Applications of DNA fingerprinting

  • Human genetics and disease

  • Systematics and taxonomy

  • Population, quantitative, and evolutionary genetics

  • Plant and animal breeding and genetics

  • Legal, forensic, and anthropological analysis

  • Genome mapping and analysis


Important timeline

Important Timeline

Discovery of DNA as the Hereditary Material in 1944

DNA structure described in 1953

Restriction endonucleases discovered in 1968-1969

DNA sequencing described in 1977

DNA fingerprinting first used in 1985

Polymerase chain reaction (PCR) invented in 1985


Deoxyribonucleic acid dna structure

DeoxyriboNucleic Acid (DNA) structure

“It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material”

(Watson and Crick 1953)


Dna fingerprinting

DNA STRUCTURE

  • DNA is the hereditary material and contains all the information needed to build an organism.

  • It is a polymeric molecule made from discrete units called nucleotides.

  • Nucleotides link together to form a DNA strand at positions 3’ and 5’

  • Nitrogenous base:

  • Purines: Adenine and Guanine

  • Pyrimidines: Thymine and Cytosine

Sugar: 2-deoxyribose

Phosphate group

Nucleotide Thymidine


Dna fingerprinting

  • 2 strands of polynucleotides:

  • Twisted around each other in clock-wise direction

  • Antiparallel: complementary and inverse

  • H-Bridges links that are specific:

G

C

A

T


Dna fingerprinting

The structure of DNA is identical in all eukaryotes, therefore the genetic information resides in the sequence of their bases

Gene is a DNA segment with a sequence of bases that has the information for a biologic function. Alternative forms of a gene are called alleles


Dna fingerprinting

  • WHERE IS THE DNA LOCATED IN EUKARYOTES?

  • A small fraction is located in the organelles:

    • Chloroplats (cpDNA): 135 to 160 kb with high density of genes

    • Mithocondria (mtDNA): 370 to 490 kb. Only about 10% are genes

    • Most of it in the nucleus:

    • 63 Mb to 150 Gb in plants; 20Mb to 130 Gb in animals

    • Number of molecules (chromosomes) highly variable: 2 to >500 in animals and 2 to >1000 in plants.

    • Just a very small fraction of the genome is actual genes.

    • Some tens of thousand genes and gene clusters are scatterd around in a vast majority of apparently non-functional DNA.

    • DNA is associated with other components (mainly proteins) and form a complex called Chromatin.

Nucleus

Mitochondria

Chloroplast

From Brooker et al. Genetics: Analysis & Principles. McGraw Hill. 2009


Dna fingerprinting

  • WHERE IS THE DNA LOCATED IN EUKARYOTES?

  • Chromatin:

  • The basic structure of chromatin is made of DNA and proteins (histones)

  • The structure of the chromatin changes throughout the cell cycle:

  • Most of the time, when the cell is not undergoing mitosis, the chromatin is relatively uncondensed. However, there are more compacted zones (heterochromatin) and less compacted zones (euchromatin, which is the majority).

  • When the cell is going to divide, the chromatin gets more and more compacted producing individualized structures called methaphasic chromosomes

From Brooker et al. Genetics: Analysis & Principles. McGraw Hill. 2009


Dna fingerprinting

DNA MUTATIONS

Changes in the nucleotide sequence of genomic DNA that can be transmitted to the descendants.

If these changes occur in the sequence of a gene, it is called a mutant allele. The most frequent allele is called the wild type.

A DNA sequence is polymorphic if there is variation among the individuals of the population.


Dna fingerprinting

DNA MUTATIONS

Types of mutations depending on the effect on the DNA sequence:

5’ – AgctgAactcgacctcgcgatccgtagttAgactag -3’

Wildtype

5’ – AgctgAactcggcctcgcgatccgtagttAgactag -3’

Substitution

(transition: A G

5’ – AgctCAactcgacctcgcgatccgtagttAGactag -3’

Substitution

(transversion: G C)

C

5’ – AgctAactcgacctcgcgatccgtagttAGactag -3’

Deletion

(single bp)

CAactcgacc

5’ – AgcttcgcgatccgtagttAGactag -3’

Deletion

(DNA segment)


Dna fingerprinting

DNA MUTATIONS

Types of mutations depending on the effect on the DNA sequence:

5’ – AgctgAactcgacctcgcgatccgtagttAgactag - 3’

Wildtype

5’ – AgctGAactAcgacctcgcgatccgtagttAGactag - 3’

Insertion

(single bp)

5’ – AgctGAactAGTCTGCCcgacctcgcgatccgtagttAGactag-3’

Insertion

(DNA segment)

5’ – AgcAGTTGAcgacctcgcgatccgtagttAGactag-3’

Inversion

Tranposition:

5’ – AgctcgacctcgcgatccgtagttAtgAacgactag- 3’


Dna fingerprinting

DNA MUTATIONS

Types of mutations depending on the effect on the protein:

5’ – AgctCAactcgacctcgcgatccgAagttAgactag- 3’

Wildtype

Arg

Ser

Ser

Leu

Asp

Lys

Asp

Thr

Arg

Pro

STOP

Pro

5’ – AgctCAactcgacctcgTgatccgAagttAgactag- 3’

Silent

Arg

Ser

Ser

Leu

Asp

Lys

Asp

Thr

Arg

Pro

STOP

Pro

5’ – AgctCAactcgacctTgcgatccgAagttAgactag- 3’

Amino acid change

Cys

Ser

Ser

Leu

Asp

Lys

Asp

Thr

Arg

Pro

STOP

Pro

A

5’ – AgctCAactcgcctcgcgatccgAagttAgactag- 3’

Frame shift

Ala

Ser

Ser

STOP

Ser

Ile

Thr

Arg

Leu

Arg

5’ – AgctCAactcgacctcgcgatccgTagttAgactag- 3’

STOP

Arg

Ser

Ser

Lys

Asp

Thr

Arg

Pro

Pro


Dna fingerprinting

REPLICATION

TRANSLATION

TRANSCRIPTION

RNA

DNA

PROTEINS


Dna fingerprinting

DNA REPLICATION

  • DNA primase: catalyzes the synthesis of a short RNA primer complementary to a single strand DNA template

  • Helicase: unwinds and separates the two strands of DNA

  • Gyrase: facilitates the action of the helicase relieving tension of the coiled DNA

  • Single Stranded DNA binding proteins (SSB): stabilize single strand DNA

  • DNA polymerase: synthesize a new DNA strand complementary to a template strand by adding nucleotides one at a time to a 3’ end.


Dna fingerprinting

POLYMERASE CHAIN REACTION – PCR

  • Invented by K.B Mullis in 1983

  • Allows in vitro amplification of ANY DNA sequence in large numbers

  • Design of two single stranded oligonucleotide primers complementary to motifs on the template DNA.


Dna fingerprinting

A Polymerase extends the 3’ end of the primer sequence using the DNA strand as a template.


Dna fingerprinting

POLYMERASE CHAIN REACTION – PCR

  • Each cycle can be repeated multiple times if the 3’ end of the primer is facing the target amplicon. The reaction is typically repeated 25-50 cycles.

  • Each cycle generates exponential numbers of DNA fragments that are identical copies of the original DNA strand between the two binding sites.

  • The PCR reaction consists of:

    • A buffer

    • DNA polymerase (thermostable)

    • Deoxyrybonucleotidetriphospates(dNTPs)

    • Two primers (oligonucleotides)

    • Template DNA

    • And has the following steps:

      • Denaturing: raising the temperature to 94 C to make DNA single stranded

      • Annealing: lowering the temperature to 35 – 65 C the primers bind to the target sequences on the template DNA

      • Elongation: DNA polymerase extends the 3’ ends of the primer sequence. Temperature must be optimal for DNA polymerase activity.


Dna fingerprinting

1st cycle

2nd cycle


Dna fingerprinting

  • http://www.dnalc.org/resources/animations/pcr.html

  • http://learn.genetics.utah.edu/content/labs/pcr/

POLYMERASE CHAIN REACTION – Links:

3rd cycle


Restriction endonucleases

Restriction Endonucleases

  • Enzymes which recognize a specific sequence of bases within double-stranded DNA.

  • Endonucleases make a double-stranded cut at the recognition site.

  • Examples:

EcoRI

5‘- G|AATTC

3‘- CTTAA|G

BamHI

5‘- G|GATCC 3‘- CCTAG|G

HindIII

5‘- A|AGCTT

3‘- TTCGA|A


Dna fingerprinting

  • A process used to separate DNA fragments

  • An electric current passes through agarose or polyacrylamide gels

  • The electrical current forces molecules to migrate into the gel at different rates depending on their sizes

From Hartwell et al. Genetics. McGraw Hill. 2008


Dna fingerprinting

Link: http://www.wellcome.ac.uk/Education-resources/Teaching-and-education/Animations/DNA/WTDV026689.htm

SANGER DNA SEQUENCING

  • Buffer

  • DNA polymerase

  • dNTPs

  • Labeled primer

  • Target DNA

ddATP

ddGTP

deoxinucleotyde (dNTP)

dideoxinucleotyde (ddNTP)

ddTTP

ddCTP


Dna fingerprinting

G

C

A

T

*TTAAGTACATACCTAGTACCACTATATAATG

*GCTTAAGTACATACCTAGTACCACTATATAATG

*TAAGTACATACCTAGTACCACTATATAATG

*GTACATACCTAGTACCACTATATAATG

*TACATACCTAGTACCACTATATAATG

*GTACCACTATATAATG

*TACCTAGTACCACTATATAATG

*TAGTACCACTATATAATG

*ACGCTTAAGTACATACCTAGTACCACTATATAATG

*CGCTTAAGTACATACCTAGTACCACTATATAATG

*AAGTACATACCTAGTACCACTATATAATG

*CATACCTAGTACCACTATATAATG

*AGTACATACCTAGTACCACTATATAATG

*CCTAGTACCACTATATAATG

Separate gel lanes

Single gel lane

*ATACCTAGTACCACTATATAATG

*CTAGTACCACTATATAATG

*ACCTAGTACCACTATATAATG

*AGTACCACTATATAATG


Dna polymorphisms

DNA polymorphisms

  • Insertion-deletion length polymorphism – INDEL

  • Single nucleotide polymorphism – SNP

  • Simple sequence repeat length polymorphism – mini- and micro-satellites


Dna fingerprinting

Allele A

Allele a

a

a

A

a

A

a

a

A

Ind 5

Ind 1

Ind 3

Ind 4

Ind 2

Ind 8

Ind 6

Ind 7


Dna fingerprinting

Allele A

Allele a

a

a

A

a

A

a

a

A

Ind 5

Ind 1

Ind 3

Ind 4

Ind 2

Ind 8

Ind 6

Ind 7


Restriction fragment length polymorphism rflp

Restriction Fragment Length Polymorphism (RFLP)

  • RFLPs (Botstein et al. 1980) are differences in restriction fragment lengths caused by a SNP or INDEL that create or abolish restriction endonuclease recognition sites.

  • RFLP assays are based on hybridization of a labeled DNA probe to a Southern blot (Southern 1975) of DNA digested with a restriction endonuclease

Labeled 3’ TGGCTAGCT 5’

Probe 3’ TGGCTAGCT 5’

|||||||||

Target 1 5’-CCTAACCGATCGACTGAC-3’ 2 5’-GGATTGGCTAGCTGACTG-3’


Dna fingerprinting

RFLP


Features of rflps

Features of RFLPs

  • Co-dominant

  • Locus-specific

  • Genes can be mapped directly

  • Supply of probes and markers is unlimited

  • Highly reproducible

  • Requires no special instrumentation


  • Login