slide1
Download
Skip this Video
Download Presentation
CHAPTER 10 RECOMBINANT DNA

Loading in 2 Seconds...

play fullscreen
1 / 42

CHAPTER 10 RECOMBINANT DNA - PowerPoint PPT Presentation


  • 121 Views
  • Uploaded on

CHAPTER 10 RECOMBINANT DNA. To understand this chapter, you must understand that The DNA double helix can be separated into two single helices by heat or chemical treatment (usually 95 C) When DNA is cooled, DNA sequences that are similar or the same will anneal (zip together). 50-60C. 95C.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' CHAPTER 10 RECOMBINANT DNA' - destiny-wilcox


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

CHAPTER 10

RECOMBINANT DNA

slide2

To understand this chapter, you must understand that

  • The DNA double helix can be separated into two single helices by heat or chemical treatment (usually 95 C)
  • When DNA is cooled, DNA sequences that are similar or the same will anneal (zip together)

50-60C

95C

slide3

To understand this chapter, you must also understand that

  • At present, sequencing technology is limiting, and genes cannot be sequenced or studied without many many copies of the same sequence.
  • Thus, considerable technical effort is devoted to getting many copies of one gene. The two processes used for this purpose are cloning and the polymerase chain reaction (PCR)
slide4

POLYMERASE CHAIN

REACTION

DIDEOXY SEQUENCING

slide5

“The fungus behind the outbreaks was initially identified as Aspergillus, but as more testing of patients has been completed, it\'s become clear that another fungus — a kind of black mold called Exserohilum (Setosphaeria) — is the primary cause. CDC\'s fungal disease laboratory confirmed Exserohilum in 10 people with meningitis and Aspergillus in just one.” 195 affected/19 dead

Serum

PCR

Sequencing

Bar code match

slide6

The fungal barcode gene

SSU

5.8S

LSU

Setosphaeria rostrata

Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae; Pleosporaceae; Setosphaeria

agaaaaatat gagggtgtgg tttgctggga acagcgtccg ccgcaggtat ttttcagcca gtgtctgttg cgcacttttt gtttcctggg cgagttcgct cgccaccagg acccaaccat aaaccttttt ttatgcagtt gcaatcagcg tcagtataat aattcaattt attaaaactt tcaacaacgg atctcttggt tctggcatcg atgaagaacg cagcgaaatg cgatacgtag tgtgaattgc agaattcagt gaatcatcga atctttgaac gcacattgcg ccctttggta ttccaaaggg catgcctgtt cgagcgtcat ttgtaccctc aagctttgct tggtgttggg cgtctttttg tctctcccct tgttggggga gactcgcctt aaaacgattg gcagccgacc tactggtttt cggagcgcag cacaaatttg cgccttccaa tccacggggc ggcatccagc aagcctttgt tttctataac aaatccacat tttgacctcg gatcaggtag ggatacccgc tgaacttaag catatcaata a

slide8

GENES CAN BE COPIED BY PCR

Uses alternating temperatures and primers specific to a gene region to make millions of copies of a gene for sequencing or study

95o separates DNA strands

52o anneals primers

primer

primer

72o copies DNA

DNA polymerase

Two identical copies

vii dna sequencing
VII. DNA SEQUENCING

DNA SEQUENCING

DNA sequencing is a procedure in which the sequence of bases in a gene is determined.

The most common method of DNA sequencing (Sanger sequencing) uses a one-directional PCR process and fluorescently-labeled dideoxy nucleotides (dideoxy nucleotides lack an oxygen on the number 3 carbon of ribose and cannot add a further nucleotide to a growing DNA strand)

Newer rapid methods of DNA sequencing have been and are being developed

dna sequencing can be done on a cloned gene or pcr product
DNA Sequencing can be done on a cloned gene or PCR product

AATCGGACTGGAGGCTTAGAACTGGATTT

PRIMER

C

Terminating fluorescently-labeled nucleotide

AATCGGACTGGAGGCTTAGAACTGGATTT

T

PRIMER

Terminating fluorescently-labeled nucleotide

dna sequencing can be done on a cloned gene or pcr product1
DNA Sequencing can be done on a cloned gene or PCR product

3’TTAGCCTGACCTCCGAATCTTGACCTA

PRIMER

AATCGGACTGGAGGCTTAGAACTGGAT

AATCGGACTGGAGGCTTAGAACTGGATTT

AATCGGAC

AATCGGACTGGAGG

AATCGGACTGGAGGCTTAGAA

dna sequencing can be done on a cloned gene or pcr product2
DNA Sequencing can be done on a cloned gene or PCR product

3’TTAGCCTGACCTCCGAATCTTGACCTA

PRIMER

3’T

3’TT

3’TTA

3’TTAG

3’TTAGC

3’TTAGCC

3’TTAGCCT

slide14

WELL

G

T

C

C

G

A

T

T

SEQUENCING GEL SEPARATES FRAGMENTS BY SIZE

An actual sequencing gel

slide16

DNA CLONING: THE PROCESS OF PLACING DNA FROM ONE ORGANISM INTO ANOTHER TO MAKE MULTIPLE COPIES

RESTRICTION ENZYMES ARE USED IN DNA CLONING

slide17

RESTRICTION ENZYMES

  • Restriction enzymes cut DNA at specific base sequences
  • Bacteria use them to defend themselves against infection
  • They are named for the bacteria that produce them
  • Eco R1 is derived from Escherichriacoli strain R-cuts palindrome GAATTC
  • HindIII is derived from Haemophilus influenza - cuts palindrome AAGCTT
  • “palindrome” – DNA sequence that is the same on both strands of DNA
slide18

CLONING CAN TAKE PLACE IN A NUMBER OF VECTORS

  • VECTOR: THE THING RECEIVING A FRAGMENT OF DNA, USUALLY A PLASMID OR VIRUS
  • MOST VECTORS HAVE BEEN GENETICALY MODIFIED TO RECEIVE DNA
  • MOST VECTORS HAVE BEEN MODIFIED SO THAT BACTERIA WITH A RECOMBINANT PLASMID CAN BE SELECTED FOR
    • -ANTIBIOTIC RESISTANCE
    • -COLOR SELECTION (BLUE WHITE COLORS)
slide19

LIBRARIES

LIBRARIES ARE A COLLECTION OF CLONED DNA FRAGMENTS

EACH FRAGMENT IS IN A DIFFERENT BACTERIAL OR VIRAL CELL

THE COLLECTION OF CELLS MAKES UP THE LIBRARY (e.g., a rice genomic library)

slide21

THERE ARE MANY DIFFERENT KINDS OF LIBRARIES

  • Complementary DNA libraries
    • -derived from mRNA only
    • -represents only gene regions of a genome
    • -mRNA is isolated using its poly A tail and reverse-copied into DNA, then cloned.
slide23

FINDING A SPECIFIC GENE IN A LIBRARY

  • NUCLEIC ACID HYBRIDIZATION IS USED TO LOCATE SPECIFIC DNA SEGMENTS USING -
    • A GENE FROM A RELATED ORGANISM
    • mRNA FROM AN INDUCED CELL
    • ANTIBODIES CAN BE USED AS PROBES
slide25

BACTERIA CONTAINING CLONED GENES HAVE COMMERCIAL VALUE

HUMAN INSULIN

HUMAN GROWTH HORMONE

ICE-MINUS PSEUDOMONAS BACTERIA

DIAGNOSTIC TOOLS (BRAC1)

BACTERIA CONTAINING CLONED GENES HAVE SCIENTIFIC VALUE

CLONED CHLOROPLAST GENES (CLEAN ENERGY)

CLONED GENES FOR PLANT DISEASE RESISTANCE

ETC

slide27

PLANTS CAN BE GENETICALLY MODIFIED

(SO CAN ANIMALS)

PLANTS WHICH HAVE RECEIVED A FOREIGN GENE ARE CALLED TRANSGENIC PLANTS

  • METHODS OF GETTING GENES INTO PLANTS TO MAKE TRANSGENIC PLANTS
    • AGROBACTERIUM
    • GENE GUN
slide29

Many plant cells are “totipotent”, i.e., a single cell has the capacity to regenerate a complete plant

protoplasts

callus

regeneration

Sugar cane plants

regeneration

slide30

Some transgenic plants are made by infecting the plant with a bacterium, Agrobacterium tumefaciens which contains a plasmid. The plasmid integrates into the plant DNA causing a gall

Agrobacterium tumifaciens or crown gall disease

slide32

insert a gene

Transform cells

Regenerate plants

slide34

Some transgenic plants are made by shooting DNA-coated particles into tissues and regenerating plants from the tissues

slide35

TRANSGENIC PLANTS

Kinds of transgenic plants

slide36

Ethylene resistance

GeneticallyModified

normal

Contains a mutant ethylene receptor gene – delayed ripening. 100 days after picking

slide37

The yellow color of this genetically modified rice is due to its ability to make Beta-carotene. It also contains a gene for a bean iron storage protein, ferritin. The modified rice will provide vitamin A and iron. 400 million people worldwide are deficient in vitamin A leading to illness and blindness. Iron is the number one micronutrient deficiency.

Novartis, Astra-Zeneca and Monsanto are claiming exclusive ownership to the basic patents related to rice research. Further, neither Monsanto nor Astra - Zeneca said they will give up their patents on rice – they merely gave royalty free licenses to public sector scientists for development of "golden rice".

Science 285:994 (Aug 1999)

slide38

Bacillus thuringiensis (BT) toxin

Upon sporulation, B. thuringiensis forms crystals of insecticidal δ-endotoxins (called crystal proteins or Cry proteins). These attach to insect gut walls and create a hole which kills the insect.

Cry toxins have specific activities against moths and butterflies, flies and mosquitoes, beetles, wasps, bees, ants, sawflies, and nematodes

European corn borer-resistant transgenic plants containing BT toxin developed by Mycogen.

Transgenic Insect-resistant cotton (Monsanto).

Plants contain BT toxin

slide39

Glyphosate (Roundup) resistant corn sprayed with herbicide to kill weeds (Monsanto). The gene has escaped and created super weeds as predicted

Not Sprayed

Sprayed

slide40

TRANSGENIC PLANTS

Opposition to transgenics

ad