Identification and selection of simple sequence repeats for mapping mutations in
This presentation is the property of its rightful owner.
Sponsored Links
1 / 11

Adalberto Castelo, Apperson Johnson, Francisco Useche, Chu Zhang PowerPoint PPT Presentation


  • 55 Views
  • Uploaded on
  • Presentation posted in: General

Identification and selection of simple sequence repeats for mapping mutations in Arabidopsis thaliana. Adalberto Castelo, Apperson Johnson, Francisco Useche, Chu Zhang. ATCGGTA ATCGGTA ATCGGTA. SSRs. Multiple copies of the same DNA sequence lying in a line series. Cause of SSRs.

Download Presentation

Adalberto Castelo, Apperson Johnson, Francisco Useche, Chu Zhang

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Adalberto castelo apperson johnson francisco useche chu zhang

Identification and selection of simple sequence repeats for mapping mutations in Arabidopsis thaliana

Adalberto Castelo, Apperson Johnson, Francisco Useche, Chu Zhang


Adalberto castelo apperson johnson francisco useche chu zhang

ATCGGTAATCGGTAATCGGTA

SSRs

Multiple copies of the same DNA sequence lying in a line series.

Cause of SSRs

The increase or decrease of repeat length can

occur due to the unequal crossover or slippage

during replication.


Adalberto castelo apperson johnson francisco useche chu zhang

Roles of Tandem Repeats

  • Mapping

  • Evolution

  • Disease related

  • Forensics

    • Relatedness

    • Identification


Adalberto castelo apperson johnson francisco useche chu zhang

CACACACACACA

White flower

Red flower

CACACACACACACACAC

PCR

Use SSR as molecular mapping markers

SSR


Adalberto castelo apperson johnson francisco useche chu zhang

Steps in SSR Process

Get Sequences

Find SSRs

Store SSRs with

Same Pats & Similar flanks in DB

Find Primers

Build Table of Results


Adalberto castelo apperson johnson francisco useche chu zhang

Location and format of Sequences

- Columbia

The Institute for Genomic Research

ftp://ftp.tigr.org/pub/data/a_thaliana/ath1/PUBLICATION_RELEASE/PSEUDOMOLECULES/

File: ATH1_pseudo_1.1con

>68198 , , , 29782728 bp

CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAAT

CTTTAAATCCTACATCCATGAATCCCTAAATACCTAATTCCCTAAACCCGAAACCGGTTT

CTCTGGTTGAAAATCATTGTGTATATAATGATAATTTTATCGTTTTTATGTAATTGCTTA

TTGTTGTGTGTAGATTTTTTAAAAATATCATTTGAGGTCAATACAAATCCTATTTCTTGT

GGTTTTCTTTCCTTCACTTAGCTATGGATGGTTTATCTTCATTTGTTATATTGGATACAA

GCTTTGCTACGATCTACATTTGGGAATGTGAGTCTCTTATTGTAACCTTAGGGTTGGTTT

ATCTCAAGAATCTTATTAATTGTTTGGACTGTTTATGTTTGGACATTTATTGTCATTCTT ...


Adalberto castelo apperson johnson francisco useche chu zhang

Location and format of Sequences

- Landsberg

The Institute for Genomic Research

Landsberg erecta random sequence Database(Ler)

ftp://ftp.tigr.org/pub/data/a_thaliana/Ler/Ler_19991208

File: TIGR_Ler_19991208.fas.htm

>Contig1 493 844

CTTTTGCTTTGTGTCTTCTAACAAGGATACAATTCTTACGCCTTTAAGATCCAATTGCAG

TTTTAGTTCTTATACTCAATCATACACATGACATCAATTCATATTCGACTCCAAAACACT

AACCAAGCTTCTTCTAGCTTCTCAAAGCTTTCATGGTGTAGCCAAAGTCTGTATGATTCT

TTGGCTTTGTATCTTCTAACAAGGAAACACTACTTAGGCTTATAAGATTGGGTTGCGGTT

TAAGTTCTTATACTAAATCATACATATGACATCAAGTCATATTCGACTCCAAAACACTAA

CCAACCTTCTTCTTGCTTCTCAAAGCTTTCATGGTTTAGCCAAAGTCCATA

>Contig4556 116 570


Adalberto castelo apperson johnson francisco useche chu zhang

Database record for an SSR

SSR:

GCA210 ->

Contig742,GCA,12,GCA210

GCAGCAGCAGCA

CCATCTTGTTCCGCCACCAGTGACGTGTACTCACCATCATATGACACCTG

GTAGCAGTAGTGGTAGTAGCCTGATGAAAGGGTGTTGCTATTCTTGTTT


Adalberto castelo apperson johnson francisco useche chu zhang

Primer (from Primer3) for SSR

MARKER_NAME=Contig742GCA210

SEQUENCE=CCATCTTGTTCCGCCACCAGTGACGTGTACTCACCATCATAT ...

TARGET=50,12

PRIMER_PAIR_PENALTY=0.9282

PRIMER_LEFT_PENALTY=0.817154

PRIMER_RIGHT_PENALTY=0.111077

PRIMER_LEFT_SEQUENCE=GCCACCAGTGACGTGTACTC

PRIMER_RIGHT_SEQUENCE=AGCAACACCCTTTCATCAGG

PRIMER_LEFT=12,20

PRIMER_RIGHT=100,20

PRIMER_LEFT_TM=59.183

PRIMER_RIGHT_TM=60.111

PRIMER_LEFT_GC_PERCENT=60.000

PRIMER_RIGHT_GC_PERCENT=50.000

PRIMER_LEFT_SELF_ANY=4.00

PRIMER_RIGHT_SELF_ANY=3.00

PRIMER_LEFT_SELF_END=4.00

PRIMER_RIGHT_SELF_END=1.00

PRIMER_LEFT_END_STABILITY=5.4000

PRIMER_RIGHT_END_STABILITY=8.2000

PRIMER_PAIR_COMPL_ANY=4.00

PRIMER_PAIR_COMPL_END=1.00

PRIMER_PRODUCT_SIZE=89


Adalberto castelo apperson johnson francisco useche chu zhang

……next steps……

Use SSRs in db

Experimental

Rate the effectiveness

Determine if we can

predict ratings

from

SSR/primer pairs


Adalberto castelo apperson johnson francisco useche chu zhang

References

Skaletsky. H. et al.,Primer3 release 0.6, Whitehead Institute for Biomedical Research.

http://www-genome.wi.mit.edu/ftp/distribution/software/README.primer3_0_6

Giraudat, et al., EMBO Practical Course on Genetic and Molecular Analysis of Arabidopsis. Module 2,

French National Center for Scientific Research (CNRS) , http://www.cnrs-gif.fr/isv/EMBO/manuals/ch2.pdf (April 11, 2001)

Mc Clintock, B. 1951. Chromosome organization and genic expression.

Cold Spring Harb. Symp. Quant. Biol. 16:13-47.

McClean, P, Transposon Tagging, NDSU 2000 - North Dakota State University, http://www.ndsu.nodak.edu/instruct/mcclean/plsc731/transposon/tag4.htm

(March 23, 1998)

Wolfgang Lukowitz et al. , Positional cloning in Arabidopsis. Why it feels good to have a genome initiative working for you. Plant Physiology, July 2000, Vol.123, pp. 795-805

Castelo, A., Tandem Repeat Occurrence Locator, SourceForge ,

http://finder.sourceforge.net (April 17, 2001)

Promega Corporation, New Approaches to DNA Fingerprint Analysis, Promega Corporation Home Page,

http://www.promega.com/pnotes/58/5189c/5189c.html?/pnotes/58/5189c/5189c.html, (May 16, 2001)


  • Login