Sco4251
This presentation is the property of its rightful owner.
Sponsored Links
1 / 1

SCO4251 PowerPoint PPT Presentation


  • 53 Views
  • Uploaded on
  • Presentation posted in: General

D bldA 1. D bldA 1. D bldA 1. D bldA 1. M600 1. M600 1. M600 1. M600 1. M600 2. M600 2. M600 2. M600 2. D bldA 2. D bldA 2. D bldA 2. D bldA 2. D. D 4263. M600. E S. E S. 4251. 4252. 4253. SCO 0762. SCO 4253. SCO4252, 4253 and 4262. SCO4246 and 4256.

Download Presentation

SCO4251

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Sco4251

DbldA

1

DbldA

1

DbldA

1

DbldA

1

M600

1

M600

1

M600

1

M600

1

M600

2

M600

2

M600

2

M600

2

DbldA

2

DbldA

2

DbldA

2

DbldA

2

D

D4263

M600

E S

E S

4251

4252

4253

SCO

0762

SCO

4253

SCO4252, 4253 and 4262

SCO4246 and 4256

A

DbldA

M600

DbldA

M600

B

SCO4251

SCO4252, basic

SCO4252, acidic

SCO4253

C

E

ggaacatgcccccgctccggcacccggggacgtttcggca

tcggcaacgcgcgcgtgaggctgaggggcgtcctgtctcg

taccccgaggagagcagagcatgccgtcctacctgtcgcccggcgtctacgtcgaggaggtggccagcggctcgcgcccg

atcgagggagtgggcacgtc


  • Login