1 / 35

What is DNA, and How is it Used in Today’s Society?

What is DNA, and How is it Used in Today’s Society?. Deoxyribonucleic Acid (DNA) DNA is found in all living things (all life related?) The hereditary material; found in the nucleus of eukaryotes (copied before each cell division; passes codes for physical traits to offspring)

dashiell
Download Presentation

What is DNA, and How is it Used in Today’s Society?

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. What is DNA, and How is it Used in Today’s Society? • Deoxyribonucleic Acid (DNA) • DNA is found in all living things (all life related?) • The hereditary material; found in the nucleus of eukaryotes (copied before each cell division; passes codes for physical traits to offspring) • Today, segments of DNA (genes) can be manipulated, and can be removed from/inserted into organisms (biotechnology, transgenic organisms) • Your DNA code is unique (excl. identical twins)  criminal and paternity applications • Genetic diseases linked to various genes  genetic screenings and counseling

  2. Figure 16.2

  3. Figure 16.4

  4. What is the Structure of DNA, and How is it Copied Before Cell Division? • Structure of DNA • A polymer, composed of nucleotides (which consist of a sugar, a phosphate group, and a nitrogenous base) • Sugar is deoxyribose • Nitrogenous bases: guanine, cytosine, adenine, and thymine • Double-stranded molecule, wound in helix (Watson, Crick, and Wilkins  Nobel Prize) • Two strands joined by hydrogen bonds (two bonds between T/A; three bonds between C/G); unzip at high temperature or via enzyme action • DNA Replication (occurs during S-phase) • Code of new strand based on original template • Enzymes involved: DNA Polymerase, Helicase

  5. Figures 16.1 and 16.5

  6. Figure 16.6

  7. Figure 16.7

  8. Figure 16.8 Figure (page 310)

  9. Figure 16.9

  10. Figures 16.10 and 16.11

  11. Figure 16.13

  12. Figure 16.14

  13. Figure 16.17

  14. What is RNA, and How Does it Differ from DNA? • Ribonucleic Acid – the Messenger Molecule (and the Original Information Molecule) • Single-stranded molecule; but can take three- dimensional shapes (stem loops, hairpins) • Sugar is ribose; bases: guanine, cytosine, adenine, and uracil (vs. thymine of DNA) • Three functional types (based on shapes) • Messenger RNA (m-RNA): transmits message of gene • Transfer RNA (t-RNA): 20 types (one for each of the 20 types of amino acids); work like enzymes • Ribosomal RNA (r-RNA): associated with proteins to form ribosomes

  15. Figure 5.27

  16. RNA HAIRPINS AND STEM LOOPS RNA Hairpins:AGCCCGGUUCGAACCGGGCU AGCCCGGUUC-I UCGGGCCAAG-I --------------------------------------------------------------------------------------------------- RNA Stem Loops:AGCCCGGUUUUUUCCGGGCU UUU  AGCCCGGI U UCGGGCCI U U

  17. What is the Role of RNA in Gene Expression? • Gene Expression: Gene (DNA)message (m-RNA)  polypeptide (protein) TRANSCRIPTIONTRANSLATION • Transcription (gene  m-RNA) • Occurs in nucleus • Nucleotide sequence of m-RNA based on code of DNA (gene) • RNA polymerase enzyme involved in process • In eukaryotes, m-RNA often edited into exons and introns; exons processed into mature m-RNA that enters cytoplasm and is used for protein synthesis

  18. Figure 17.3

  19. Figure 17.7

  20. Figures 17.9 and 17.10

  21. Figures 17.11 and 17.12

  22. How are Proteins Synthesized Based on Genetic Instructions? • Translation (Protein synthesis: m-RNA  polypeptides) • Occurs at ribosomes (in rough ER or cytoplasm) • t-RNA, bound to amino acids, associates with ribosome • Order of amino acids determined by GENETIC CODE: m-RNA codons (base triplets) bind to anticodons of t-RNAs; amino acids join (peptide bonds) to form polypeptides • Polyribosomes found in cells that exhibit high levels of protein synthesis (when many copies of same poly- peptide are routinely synthesized)

  23. Figures 17.13 and 17.14

  24. Figure 17.4 and 17.5

  25. Figure 17.16

  26. Figure 17.17

  27. Figure 17.18

  28. Figure 17.19

  29. Figure 17.20

  30. Overview of Gene Expression AAAACTCCCGGTATGAACCATATAT start stop TRANSCRIPTION  GAGGGCCAUACUUGG TRANSLATION  glu – gly –his – thr –try

  31. Figure 17.25

  32. What are Genetic Mutations, and What are Their Effects? • Mutations: changes in DNA code; occur during replication • Genetic Code with “wobbly” third base • If AUU mutates to AUC?  no effect • If AUU mutates to ACU?  threonine replaces isoleucine • Change in amino-acid sequence may or may not change function of protein; typically involves changes in shape or charge • Point mutations: change in one base (often random; mutation rates can be increased by mutagens) • If wobble effect, no change in amino acid • Enzymes repair mutations at given rate, can be “overwhelmed” • Ex. Sickle-cell anemia: one of 146 amino acids in hemoglobin protein “in error” • Frame-shift mutations: large-scale error; shift in code • Genetic Cancers • Breast, ovarian, and colon cancers run in families (among others) • Oncogenes: genes that are associated with high rates of cancers • Tumor-suppressor genes: if mutated, more likely to develop cancer

  33. Figure 17.23

  34. Figure 18.22

More Related