Genomics
This presentation is the property of its rightful owner.
Sponsored Links
1 / 35

Genomics PowerPoint PPT Presentation


  • 104 Views
  • Uploaded on
  • Presentation posted in: General

Genomics. Marco Marra, Ph.D. Director, British Columbia Cancer Agency Genome Sciences Centre. Overview. Rationale and Background Cells and biomolecules Special Challenges for Genomics, Bioinformatics, Proteomics and related technologies. Rationale.

Download Presentation

Genomics

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Genomics

Genomics

Marco Marra, Ph.D.

Director,

British Columbia Cancer Agency

Genome Sciences Centre


Overview

Overview

Rationale and Background

Cells and biomolecules

Special Challenges for Genomics, Bioinformatics,

Proteomics and related technologies


Rationale

Rationale

There are a staggering number of cells in the human body.

Most of these cells contain genetic material; all of the cells contain protein and other chemical entities.

The information encoded in the genetic material is somehow “understood” and interpreted by cells.

The correct cellular interpretation is essential for normal development and health of the organism.

Disease can result due to complex interactions between largely unidentified genes and poorly understood environmental factors.


Rationale1

Rationale

Development is complex and requires the (poorly

understood) interaction between many genes and gene

products (RNA and protein).

Development requires that the correct genes must be

turned on and off in the correct tissues at the

correct time. This is known as “regulation” of gene

Expression. Mis-regulation of gene expression can

produce disease.

To identify the many unknown genes involved in

Development and disease, tools capable of “high

throughput” and applicable at “large scale” are required.

These are the tools of Genomics.


What is genomics

What is genomics?

The term "genomics" was coined by mouse geneticist Tom Roderick to

describe an approach to the study of DNA at the level of chromosomes,

entire genomes, or large clusters of genes. The purpose of the term was

to distinguish it from more traditional genetic approaches that focused on

one gene or a family of functionally or structurally related genes or sequences.

In addition to this scientific concept, genomics alsoimplied large scale and a

"whiz-bang" high tech approachto studying DNA structure. Implicitly,

genomics implied creating and using large databases, extensive use of

laboratory automation, and generally a more "capital intensive biology,"

than was the norm in the mid-1980s.


Genome bc sponsored technologies

Genome BC sponsored technologies

  • Bioinformatics (S. Jones, BCCA GSC)

  • DNA sequencing (M. Marra, BCCA GSC; B. Koop, U.Victoria)

  • BAC fingerprint mapping (J. Schein, BCCA GSC)

  • Model organism genetics (D. Moerman, UBC)

  • Genotyping (A. Brooks-Wilson & M. Marra, BCCA GSC)

  • cDNA Microarrays (C. Nelson, JBRC & VGH)

  • Proteomics (R. Olafson, U.Victoria)

  • Technology development (A. Marziali, UBC)


Life begins with the fusion of two cells

Life begins with the fusion of two cells


What is the genome

What is “the Genome?”


Genomics

DNA

Humans are made up of ~100 trillion cells.

Each cell contains ~2 meters of DNA.

Each human contains 200 trillion meters of DNA.

This equals 200 billion kilometers of DNA.

The distance from Earth to Sun is 150 million kilometers.

The amount of DNA in every one of us is sufficient to

stretch between the Earth and the Sun ~1,300 times.


The central dogma of molecular genetics

The Central Dogma of Molecular Genetics

DNA

RNA

Protein


The central dogma of molecular genetics1

Protein 1

Protein 2

Protein 1

Protein 2

Protein 1

Protein 2

Protein 1

Protein 2

Protein 1

Protein 2

The Central Dogma of Molecular Genetics

RNA

DNA

(a gene)

RNA

RNA

RNA

RNA


Cell nucleus chromosome and dna

Cell, nucleus, chromosome and DNA


Gene structure

Gene Structure


Mrna the intermediate between dna and protein

mRNA - The intermediate between DNA and protein


Proteins the engines of the cell have complicated 3 d structures

Proteins, theengines of the cell, have complicated 3-D structures


Genomics

GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAA

GTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAG

DNA Sequence


Exons and introns

GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAA

GTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAG

Exons and introns


The genetic code

The genetic code*

UUC = Cys

UAA = STOP

* From Molecular Biology of the Cell, 3rd edition


Proteins

Proteins

Bovine insulin


Proteins1

Proteins

Proteins can be

modified in many

ways.


Genomics

The consequences of

variation in the genome

(phenotypic variation)


Genomics

The consequences of variation in

the genome (disease)


Glycolysis

Glycolysis


Metabolism

Metabolism


Applications

Applications

  • Health

  • Provision of:

  • Diagnostic markers

  • Prognostic indicators

  • “Custom” therapies

  • Avoidance of ADRs

  • New therapeutics

  • etc

  • Agriculture

  • Characterization of:

  • Pest resistant crops

  • Drought resistant crops

  • Disease resistant herds

  • etc


Genome b c research portfolio

Genome B.C. Research Portfolio*

Aquaculture

Genomics Research on Salmon (SFU & UVic)

Environment

Microbial Envirogenomics (UBC)

Ethics (Ethical, Environmental, Economic, Legal and Societal)

Democracy, Ethics and Genomics(UBC)

Forestry

Forestry Genomics (UBC)

Health

Studies of Early Stage Cancer (B.C. Cancer Agency)

Bioinformatics of Mammalian Gene Expression (B.C. Cancer Agency)

Atlas of Gene Expression in Mouse Development (B.C. Cancer Agency)

The Nematode as a Model Organism (SFU & UBC)

Genomics of the Pathogen Cryptococcus neoformans (UBC)

Expression Profiles ofCells & Tissues C. elegans (SFU)

*Courtesy B. Schmidt, Genome BC


Genomics

DNA Sequencing Movie


Government and non profit funding

Government and non-profit funding


Genome canada

Genome Canada*

  • Genome Canada is a not-for-profit corporation dedicated to developing and implementing a national strategy in genomics research for the benefit of all Canadians. Genome Canada has received $375 million to date from the federal government to fund five research centres across the country.

  • Genome Canada and these 5 Genome Centres (Atlantic, Québec, Ontario, Prairies and BC) work closely with other partners such as provincial governments, the private sector and national and international foundations to ensure that Canada becomes a world leader in genomics research in key selected areas such as Agriculture, Environment, Fisheries, Forestry and Health.

*Courtesy B. Schmidt, Genome BC


Special challenges

Special Challenges

Development of new technologies continues apace, with the aim of increasing throughputs, decreasing operating costs and more sophisticated approaches and tools.

State of the art robotics and computers have a life span of ~2 years. A minimum requirement for maintenance of a nationally and internationally competitive research community requires an ongoing commitment to access and operate state of the art technologies.

Effective training of young genome researchers relies on the existence of established genomics research programs and platforms.

Retention of established researchers relies on their ability to conduct internationally competitive research.


British columbia genomics community representative

British Columbia Genomics Community*(Representative)

* Courtesy B. Schmidt, Genome BC


Genomics

BC Cancer Agency


Genomics

Thank you for your support of the

BC Cancer Agency and

Genome British Columbia!


  • Login