genomics
Download
Skip this Video
Download Presentation
Genomics

Loading in 2 Seconds...

play fullscreen
1 / 35

Genomics - PowerPoint PPT Presentation


  • 150 Views
  • Uploaded on

Genomics. Marco Marra, Ph.D. Director, British Columbia Cancer Agency Genome Sciences Centre. Overview. Rationale and Background Cells and biomolecules Special Challenges for Genomics, Bioinformatics, Proteomics and related technologies. Rationale.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Genomics' - darci


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
genomics

Genomics

Marco Marra, Ph.D.

Director,

British Columbia Cancer Agency

Genome Sciences Centre

overview
Overview

Rationale and Background

Cells and biomolecules

Special Challenges for Genomics, Bioinformatics,

Proteomics and related technologies

rationale
Rationale

There are a staggering number of cells in the human body.

Most of these cells contain genetic material; all of the cells contain protein and other chemical entities.

The information encoded in the genetic material is somehow “understood” and interpreted by cells.

The correct cellular interpretation is essential for normal development and health of the organism.

Disease can result due to complex interactions between largely unidentified genes and poorly understood environmental factors.

rationale1
Rationale

Development is complex and requires the (poorly

understood) interaction between many genes and gene

products (RNA and protein).

Development requires that the correct genes must be

turned on and off in the correct tissues at the

correct time. This is known as “regulation” of gene

Expression. Mis-regulation of gene expression can

produce disease.

To identify the many unknown genes involved in

Development and disease, tools capable of “high

throughput” and applicable at “large scale” are required.

These are the tools of Genomics.

what is genomics
What is genomics?

The term "genomics" was coined by mouse geneticist Tom Roderick to

describe an approach to the study of DNA at the level of chromosomes,

entire genomes, or large clusters of genes. The purpose of the term was

to distinguish it from more traditional genetic approaches that focused on

one gene or a family of functionally or structurally related genes or sequences.

In addition to this scientific concept, genomics alsoimplied large scale and a

"whiz-bang" high tech approachto studying DNA structure. Implicitly,

genomics implied creating and using large databases, extensive use of

laboratory automation, and generally a more "capital intensive biology,"

than was the norm in the mid-1980s.

genome bc sponsored technologies
Genome BC sponsored technologies
  • Bioinformatics (S. Jones, BCCA GSC)
  • DNA sequencing (M. Marra, BCCA GSC; B. Koop, U.Victoria)
  • BAC fingerprint mapping (J. Schein, BCCA GSC)
  • Model organism genetics (D. Moerman, UBC)
  • Genotyping (A. Brooks-Wilson & M. Marra, BCCA GSC)
  • cDNA Microarrays (C. Nelson, JBRC & VGH)
  • Proteomics (R. Olafson, U.Victoria)
  • Technology development (A. Marziali, UBC)
slide10
DNA

Humans are made up of ~100 trillion cells.

Each cell contains ~2 meters of DNA.

Each human contains 200 trillion meters of DNA.

This equals 200 billion kilometers of DNA.

The distance from Earth to Sun is 150 million kilometers.

The amount of DNA in every one of us is sufficient to

stretch between the Earth and the Sun ~1,300 times.

the central dogma of molecular genetics1

Protein 1

Protein 2

Protein 1

Protein 2

Protein 1

Protein 2

Protein 1

Protein 2

Protein 1

Protein 2

The Central Dogma of Molecular Genetics

RNA

DNA

(a gene)

RNA

RNA

RNA

RNA

slide17

GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAAGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAA

GTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAG

DNA Sequence

exons and introns

GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAAGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAA

GTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAG

Exons and introns
the genetic code
The genetic code*

UUC = Cys

UAA = STOP

* From Molecular Biology of the Cell, 3rd edition

proteins
Proteins

Bovine insulin

proteins1
Proteins

Proteins can be

modified in many

ways.

slide23

The consequences of

variation in the genome

(phenotypic variation)

applications
Applications
  • Health
  • Provision of:
  • Diagnostic markers
  • Prognostic indicators
  • “Custom” therapies
  • Avoidance of ADRs
  • New therapeutics
  • etc
  • Agriculture
  • Characterization of:
  • Pest resistant crops
  • Drought resistant crops
  • Disease resistant herds
  • etc
genome b c research portfolio
Genome B.C. Research Portfolio*

Aquaculture

Genomics Research on Salmon (SFU & UVic)

Environment

Microbial Envirogenomics (UBC)

Ethics (Ethical, Environmental, Economic, Legal and Societal)

Democracy, Ethics and Genomics (UBC)

Forestry

Forestry Genomics (UBC)

Health

Studies of Early Stage Cancer (B.C. Cancer Agency)

Bioinformatics of Mammalian Gene Expression (B.C. Cancer Agency)

Atlas of Gene Expression in Mouse Development (B.C. Cancer Agency)

The Nematode as a Model Organism (SFU & UBC)

Genomics of the Pathogen Cryptococcus neoformans (UBC)

Expression Profiles ofCells & Tissues C. elegans (SFU)

*Courtesy B. Schmidt, Genome BC

genome canada
Genome Canada*
  • Genome Canada is a not-for-profit corporation dedicated to developing and implementing a national strategy in genomics research for the benefit of all Canadians. Genome Canada has received $375 million to date from the federal government to fund five research centres across the country.
  • Genome Canada and these 5 Genome Centres (Atlantic, Québec, Ontario, Prairies and BC) work closely with other partners such as provincial governments, the private sector and national and international foundations to ensure that Canada becomes a world leader in genomics research in key selected areas such as Agriculture, Environment, Fisheries, Forestry and Health.

*Courtesy B. Schmidt, Genome BC

special challenges
Special Challenges

Development of new technologies continues apace, with the aim of increasing throughputs, decreasing operating costs and more sophisticated approaches and tools.

State of the art robotics and computers have a life span of ~2 years. A minimum requirement for maintenance of a nationally and internationally competitive research community requires an ongoing commitment to access and operate state of the art technologies.

Effective training of young genome researchers relies on the existence of established genomics research programs and platforms.

Retention of established researchers relies on their ability to conduct internationally competitive research.

slide35

Thank you for your support of the

BC Cancer Agency and

Genome British Columbia!

ad