DNA
This presentation is the property of its rightful owner.
Sponsored Links
1 / 33

PCR - REAZIONE a CATENA della POLIMERASI PowerPoint PPT Presentation


  • 127 Views
  • Uploaded on
  • Presentation posted in: General

DNA. 1. PCR. 1 x 10 9. PCR. Primer a RNA. 3’. 5’. Nuovo filamento. 5’. 3’. DNA stampo. DNA polimerasi. Primer oligonucleotidico. DNA polimerasi termostabile. Nuovo filamento. DNA stampo. 3’. 5’. 3’. 5’. Primers a RNA. Nuovo filamento. 3’. 3’. 5’. 5’.

Download Presentation

PCR - REAZIONE a CATENA della POLIMERASI

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Pcr reazione a catena della polimerasi

DNA

1

PCR

1 x 109

PCR

Primer a RNA

3’

5’

Nuovo filamento

5’

3’

DNA stampo

DNA polimerasi

Primer oligonucleotidico

DNA polimerasi termostabile

Nuovo filamento

DNA stampo

3’

5’

3’

5’

Primers a RNA

Nuovo filamento

3’

3’

5’

5’

PCR - REAZIONE a CATENA della POLIMERASI

E’ “IL” mezzo per produrre in vitro grandi quantità di una specifica sequenza di DNA, partendo da DNA estremamente complesso.

Il principio a cui si ispira la PCR è la replicazione del DNA:

REPLICAZIONE


Pcr reazione a catena della polimerasi

DENATURAZIONE:

Il DNA viene denaturato mediante riscaldamento in provetta a ~ 92-95°C

Denaturazione

(~ 95°C)

Allungamento

(~ 70°C)

ANNEALING:

La miscela viene raffreddata fino a raggiungere la temperatura che garantisce la specifica ibridazione dei primers alle regioni dello stampo ad essi complementari

Annealing

(~ 60°C)

ALLUNGAMENTO:

La temperatura della miscela viene portata a 68-72°C consentendo alla DNA polimerasi termostabile di sintetizzare il filamento complementare allo stampo a partire dall’innesco oligonucleotidico

Le FASI della PCR


Pcr reazione a catena della polimerasi

regione di interesse

I°step

III°step

5’

3’

i filamenti vengono separati ed i primers si appaiano

complementarietà al primer 1

3’

5’

i filamenti vengono separati ed i primers si appaiano

5’

3’

primer 1

primer 2

3’

3’

3’

5’

5’

5’

3’

5’

i primers si estendono

complementarietà al primer 2

i primers si estendono

complementarietà al primer 1

5’

3’

II°step

complementarietà al primer 2

i filamenti vengono separati ed i primers si appaiano

3’

5’

Frammenti desiderati

(quelli di lunghezza variabile non sono mostrati)

i primers si estendono

5’

5’

5’

3’

3’

3’

3’

3’

5’

5’

5’

5’

3’

3’

E così via

filamenti di lunghezza variabile

filamenti di lunghezza omogenea

PCR


Pcr reazione a catena della polimerasi

Amplificazione

esponenziale

4° ciclo

3° ciclo

Frammento desiderato

2° ciclo

1° ciclo

35° ciclo

DNA stampo

Numero di copie di DNA contenenti il frammento desiderato

23 = 8

24 = 16

235

21 = 2

22 = 4

Numero di copie di DNA della corretta lunghezza contenenti il frammento desiderato

2

8

0

0

I primi 4 cicli della PCR in dettaglio


Pcr reazione a catena della polimerasi

Lunghezza: 16 bp o più

Una sequenza di 16 bp sarà statisticamente presente solo una volta ogni 416 bp (~ 4 miliardi di basi) corrispondenti circa alla grandezza del genoma umano.

T annealing

~ 2-5°C al di sotto della più bassa Tm dei due primers usati

~

Tm primer 1

Tm primer 2

Se la Ta dei due primers è molto diversa si possono verificare amplificazioni asimmetriche o a singolo filamento.

La Tmdipende dalla lunghezza e dalla sequenza del primers

Tm = 4(G+C)+2(A+T)°C

Assenza di sequenze ripetute invertite che possano far ripiegare il primers su se stesso o di sequenze complementari fra i primers che causano l’amplificazione di dimeri dei primers

PROGETTAZIONE dei PRIMERS

Caratteristiche di un buon primer:


Pcr reazione a catena della polimerasi

rev

for

3314

rev

842

425

GGACACGTATGCCACAGCCC

TGCTAAATTTTCCAGCTAGGTAGCAGGACACGTATGCCACAGCCCTTAAAAGCATATCTGCACATGTCTT

1442 1461

5’-

-3’

2264 2281

CATGCATGATGCTCAAATGCCGCATTGTTGCGCTGTACGCACACATGTATGAATGCATGGCACGGATCAA GTTGCGCTGTACGCACAC

3’-

-5’

GTGTGCGTACAGCGCAAC

GGGTGGGACCTGGGCGCCCCCGCCGTGAGCGCCTACTGCTCCACCTGGGACGCCGGCAAGCCGTACTCG

1859 1876

5’-

-3’

PROGETTAZIONE “COMPUTERIZZATA” dei PRIMERS

Primer FOR

Primability of Match = 100%

Stability of Match = 82%

Primer REV

Primability of Match = 100%

Stability of Match = 81%

Primer REV

Primability of Match = 71%

Stability of Match = 44%


Pcr reazione a catena della polimerasi

5’

5’

CTTTTGGCATAGACCACATGCCA

TGTTACAAGTGTGGATGGATGCC

Minimum stem size:

Minimum 3’ overlap:

4

Open file

Calculate

?

Clear

2

Optimal annealing temperature is 56.7. 3’ end of oligo 1 pairs to positions 5 to 10 of itself.

...PROGETTAZIONE “COMPUTERIZZATA” dei PRIMERS

Tm = 56.1

Tm = 58.6

GGCCAGTGAATTCAGCTCACGCCCCAAATATGCAGCTTCCAGTCCAGTTTCATCCGGCGCGCTGAAGATTTTTTAGAGCATGCTCTATTATGCAGCGTCCGTTGGAATGCTCTTTTTAACTCCGCGCGCGCTAAACTTGCGATTTTTTGGGCGCGGCGCTGATATTGGGCGTCTGTTGAAGATGCTCTTAAGTGGCCACAAGGGAGATGGGTCGGGCTAAGGTTTCATATCTTACAATATAAAGTTGAAGACGATTTGTGGCACCCAGGGGCGGGAGACGCATGCATGCAGCTGCATGATTGCACCAAGATCCGAAGAGTGGTTTATGGTTTGAGCTTAATTACTGCATGCATGCAACTTTTTGGTACAACTTTTGGCATAGACCACATGCCATCCCACCTCCCATGCTTTTCATTTTTACTTGTAAATTTGGATCTATTATATCTTTTGAATCAAAAGTTCAATTTATATTTCGTTTGCGTATTCTTGTCCCTTGTGTCGAGAGCTTTGAAACAAGCCCACTTTTGAATACGTTTTGACAAATTCTAAAAACTTAAGTGAGTTTCAACTGCTAAAACTTGATAGAATGAATGAAAAATTTAGCAAGTTTCAAAGACTAAAACTGAAACCCTAAGCCCTTAGCCCTAGATCCTAAGCCCTAAGCCGGAAGTCCTAAACCGTATGCCCCTAACA

Tm = 83.6


Pcr reazione a catena della polimerasi

Mg2+

dNTP

DNA a doppio filamento

Stampo

Oligonucleotidi complementari a regioni dei filamenti opposti che fiancheggiano la sequenza DNA bersaglio

Primers

Miscela equimolare di dATP, dTTP, dGTP, dCTP

Deossiribonucleotidi trifosfati

Tampone contenente cloruro di magnesio

Lo ione Mg2+ è essenziale per il funzionamento dell’enzima

Tradizionalmente viene usata la Taq polimerasi, enzima termostabile estratto dal batterio termofilo Thermus aquaticus

Enzima

COMPONENTI di una REAZIONE di PCR


Pcr reazione a catena della polimerasi

Non utilizzare quantità eccessive di stampo, primers e/o dNTP al fine di evitare amplificazioni non specifiche.

Dosare accuratamente la [Mg2+] in funzione della quantità di stampo, primers e dNTP utilizzata

Mg2+ è indispensabile al funzionamento della Taq polimerasi, ma è chelato da stampo, primers e dNTP.

Se in eccesso causa una perdita di fedeltà da parte dell’enzima.

Selezionare l’enzima più idoneo alle proprie necessità

Emivita alla temperatura di denaturazione

Processività

Capacità di correzione degli errori

Taq,

Pfu...

I FATTORI CRITICI della PCR

…nella miscela di reazione


Pcr reazione a catena della polimerasi

I FATTORI CRITICI della PCR

…nella programmazione

TEMPERATURA e TEMPO

di DENATURAZIONE

91-97°C a seconda della complessità dello stampo

94°C

1’

30 cicli di denaturazione di 1 min

Emivita Taq polimerasi: 30 min a 95°C

TDEN › 95°C o N. cicli › 30

Diminuire il tempo di denaturazione/ciclo

~

~

NUMERO di CICLI

Dipende da [stampo]iniziale

TANN troppo bassa

amplificazione aspecifica

3x105 molecole iniziali

TANN troppo alta

amplificazione con bassa resa

25-30 cicli

TMELTING

TANN

50 molecole iniziali

o

primers lunghi

40-45 cicli

N.B.

Dopo 30-35 cicli:

- l’attività dell’enzima si riduce

- primers e dNTP si esauriscono

72°C

1’

Quindi, se:

TEMPERATURA e TEMPO di ANNEALING

60°C

30’’

Allungare il tempo di annealing

TEMPERATURA e TEMPO di ALLUNGAMENTO

TEMPERATURA: 68-72°C a seconda dell’enzima

TEMPO: 1min / Kb di amplificato

ALLUNGAMENTO FINALE di 7-10 min per completare la sintesi degli eventuali prodotti parziali


Pcr reazione a catena della polimerasi

PCR CLASSICA

TOUCHDOWN PCR

Den.

iniziale

1

ciclo

94°C

3-5 min

Den.

iniziale

1

ciclo

94°C

3-5 min

Den. 30 sec 94°C

Ann. 30 sec Tm(+5°C) -1°C/ciclo

All. 1 min/Kb 72°C

Den. 30 sec 94°C

Ann. 30 sec Tm(-5°C)

All. 1 min/Kb 72°C

30

cicli

10

cicli

Den. 30 sec 94°C

Ann. 30 sec Tm(-5°C)

All. 1 min/Kb 72°C

All.

finale

1

ciclo

7 min

72°C

20

cicli

Manteni-mento

4°C

All.

finale

1

ciclo

7 min

72°C

Manteni-mento

4°C

STRATEGIE per AUMENTARE la SPECIFICITA’


Pcr reazione a catena della polimerasi

HOT START

NESTED PRIMER PCR

Procedura:

Perché realizzare una PCR “hot start”?

L’amplificazione è realizzata con un set di primers

Durante l’allestimento della reazione di PCR o durante il riscaldamento iniziale del campione si possono verificare situazioni di appaiamento non specifico fra primers e stampo.

Fra 40 e 50°C la Taq polimerasiha un’efficiente attività polimerasica e può estendere i primers non correttamente appaiati.

Il prodotto è riamplificato con un set di primers interni ai precedenti

Ia PCR

5’

3’

3’

5’

La PCR “hot start” previene la formazione di questi prodotti non specifici in quanto un componente chiave della miscela di reazione (enzima o MgCl2) viene aggiunto dopo lo step di denaturazione iniziale.

3’

5’

IIa PCR

pr. nested

pr. nested

3’

5’

5’

5’

3’

3’

NOVITA’:

Enzimi “Hot start”

Gocce di cera

5’

I prodotti non specifici amplificati nella Ia PCR non saranno amplificati nella IIa

3’

3’

5’

...STRATEGIE per AUMENTARE la SPECIFICITA’


Pcr reazione a catena della polimerasi

La Taq e altre polimerasi hanno un’attività trasferasi-terminale che conduce all’aggiunta di un singolo nucleotide all’estremità 3’ dei prodotti di PCR.

In presenza dei 4 dNTPs è preferenzialmente aggiunto dA.

Siti di clonaggio multiplo

5’

A-3’

3’-A

5’

I prodotti di PCR possono quindi essere agevolmente clonati in plasmidi aperti che contengono un deossitimidin nucleoside (dT) alle estremità 5’.

CLONAGGIO dei PRODOTTI di PCR

T

T

r


Pcr reazione a catena della polimerasi

Produzione di sonde oligonucleotidiche

Clonaggio e manipolazione dei geni

PCR

PCR

PCR

PCR

PCR

PCR

PCR

PCR

PCR

PCR

Mutagenesi casuale o sito-specifica

Tipizzazione dei geni e del DNA:

-caratterizzazione di ricombinanti batterici

-diagnosi cliniche

-analisi di campioni biologici in medicina legale

APPLICAZIONI della PCR


Pcr reazione a catena della polimerasi

STRATEGIA

Caso 1:

Caso 2:

Sequenza genica omologa nota

o

sequenza proteica nota

Sequenza genica nota

Si disegna un primer degenerato

Si disegna un primer specifico

Primers degenerati

Si amplifica il gene desiderato direttamente dal DNA genomico o dall’’RNA

Presentano varie opzioni a certe posizioni della sequenza rendendo possibile l’annealing e l’amplificazione di sequenze omologhe da organismi differenti

N.B.

I primers possono essere disegnati in maniera tale da contenere al 5’ la sequenza di specifici siti di restrizione che possono essere sfruttati per l’inserimento dei prodotti di PCR nei vettori di clonaggio.

R = A, GH = A, C, T

Y = C, TB = C, G, T

W = A,TV = A, C, G

M = A,CD = A, G, T

K = G, TN o I= A, C, G, T

S = C, G

5’-TCGAATTCNCCYAAYTGNCC-3’

EcoRI

CLONAGGIO e MANIPOLAZIONE di GENI


Pcr reazione a catena della polimerasi

mRNA

Trascrittasi inversa

+ GSP1

II° gruppo di amplificazioni

Sintesi primo filamento cDNA

GSP2

Aggiunta coda omopolimera al primo filamento cDNA

Trasferasi terminale

+ dATP

3’-AAAAAAAAA

5’

Sintesi secondo filamento cDNA

GSP1

GSP1

GSP1

GSP1

GSP1

GSP1

5’

GSP2’

complementarietà al primer

3’

P

P

P’

P’

P

P

P

P’

P

GSP2

5’

I° gruppo di amplificazioni

3’

TTTTT

TTTTT

TTTTT

TTTTT

TTTTT

TTTTT

P

3’-AAAAAAAAA

5’

TTTT

7-mG

7-mG

AAAAA-3’

AAAAA-3’

5’

Prodotto PCR finale

GSP1’

3’

3’

5’

GSP1

AAAAA

AAAAA

AAAAA

complementarietà al primer

P(dT)

5’

5’

3’

3’

GSP1’

GSP1’

5’

5’

3’

3’

5’ - RACE Rapid Amplification Complementary Ends


Pcr reazione a catena della polimerasi

mRNA

Trascrittasi inversa

+ P(dT)

Sintesi primo filamento cDNA

GSP2

Sintesi secondo filamento cDNA

3’

5’

P

P

TTTTT

TTTTT

GSP1

GSP1

GSP1

I° gruppo di amplificazioni

complementarietà al primer

GSP2

5’

7-mG

7-mG

AAAAAAAA-3’

AAAAAAAA-3’

AAAAA

AAAAA

AAAAA

P’

P’

P’

3’

3’

3’

3’

P

P

P

P

TTTTT

TTTTT

TTTTT

TTTTT

5’

GSP1

GSP1

II° gruppo di amplificazioni

3’

5’

5’

complementarietà al primer

P(dT)

3’

5’

5’

GSP1’

GSP1’

Prodotto PCR finale

GSP2’

3’ - RACE Rapid Amplification Complementary Ends


Pcr reazione a catena della polimerasi

ER OR PRONE PCR

~

PREMESSA:

La frequenza di errore delle DNA polimerasi è

allo 0,001 ‰ (una base ogni 106 nucleotidi)

grazie ad un’attività corretrice 3’ 5’ che rimuove i nucleotidi male incorporati.

MUTAGENESI CASUALE

?

In che modo delle mutazioni nel gene influenzano la funzione del prodotto?

R

E’ possibile indurre l’aumento di errori nella PCR utilizzando:

Taq polimerasi prive di attività correttrice

Basse temperature di annealing che diminuiscono la fedeltà

Ineguali concentrazioni dei dNTP

Elevate concentrazioni di MgCl2

Alto numero di cicli (60-80)

Amplificazioni successive del prodotto di PCR


Pcr reazione a catena della polimerasi

LEGENDA

sequenza bersaglio

primer con differenza di un solo nucleotide

nucleotide originale

1

4

nucleotide cambiato

PCR

2

PCR

3

Filamento 4

Filamento 1

Filamento 3

Filamento 2

Denaturazione, rinaturazione

Filamento 1

Filamento 4

Filamento 2

Filamento 3

MUTAGENESI SITO-SPECIFICA

DNA lineare amplificato

DNA plasmidico circolare con incisure e nucleotide cambiato

Trasformazione di E. coli


Pcr reazione a catena della polimerasi

Amplificazione sequenza bersaglio

+

quantificazione dell’espressione genica

identificazione del prodotto di amplificazione specifico rispetto a prodotti aspecifici

analisi simultanea di due campioni nella stessa reazione

individuazione di mutazioni puntiformi

… on-line e in tempo reale!

REAL-TIME PCR


Pcr reazione a catena della polimerasi

Caratteristiche:

Rapide variazioni di temperatura durante i cicli termici

Come mezzo di trasmissione della temperatura dalla resistenza ai campioni viene utilizzata l’aria che, essendo virtualmente senza massa, rende questo processo molto veloce.

Le reazioni vengono preparate in capillari di vetro borosilicato che, avendo un alto rapporto superficie:volume, assicurano una rapida equilibrazione fra l’aria ed i componenti della reazione.

Una reazione di PCR di 30-40 cilci può essere completata in 20-30 min.

Monitoraggio on-line e simultaneo dell’amplificazione dei vari campioni mediante sistemi di rilevamento della fluorescenza

LigthCycler SYSTEM

Roche


Pcr reazione a catena della polimerasi

L’unità ottica è dotata di un LED come sorgente di luce e di tre canali di rilevamento che misurano la luce emessa a tre differenti lunghezze d’onda:

530nm 640nm710nm

resistenza

capillari

(max 32)

I valori di fluorescenza rilevati vengono visualizzati sullo schermo del computer consentendo il monitoraggio on-line della reazione di PCR.

camera termica

ventilatore

L’intensità del segnale prodotto dal fluoroforo è proporzionale alla quantità del prodotto di PCR.

filtri

LED

canali di rilevamento fluorimetrico

Fluorescenza

L’aumento dell’intensità del segnale inizia a cicli differenti a seconda della concentrazione iniziale del DNA bersaglio.

Numero di cicli

...LigthCycler SYSTEM


Pcr reazione a catena della polimerasi

E’ un colorante fluorescente che si lega solo al DNA a doppio filamento ed emette la fluorescenza solamente in queste condizioni.

DENATURAZIONE

Non viene rilevata fluorescenza

ANNEALING

L’intensità della fluorescenza comincia ad aumentare

SYBR Green

Primer

Luce emessa

ALLUNGAMENTO

L’intensità della fluorescenza continua ad aumentare e diventa massima al termine della fase di allungamento

Polimerasi

L’AUMENTO DELLA FLUORESCENZA E’ REGISTRATO A 530nm

SYBR Green


Pcr reazione a catena della polimerasi

SONDE di IBRIDAZIONE

Due sonde oligonucleotidiche sequenza-specifiche, marcate con coloranti diversi, ibridizzano con la sequenza bersaglio sul filamento di DNA amplificato in un arrangiamento testa-coda che consente l’emissione della fluorescenza.

Oligo 1

Fluoresceina

Oligo 2

LC Red 640

Prodotto di amplificazione

Colorante accettore

Trasferimento

Colorante donatore

DENATURAZIONE

Non viene rilevata fluorescenza:

il colorante donatore è eccitato dalla sorgente ed emette energia in grado di eccitare l’accettore solo se la distanza fra i due è pari a 1-5 nucleotidi

Eccitazione

Emissione

1-5 nucleotidi

ANNEALING

Viene registrata la massima fluorescenza

L’AUMENTO DELLA FLUORESCENZA E’ REGISTRATO A 640nm


Pcr reazione a catena della polimerasi

Consente di identificare il prodotto di amplificazione specifico rispetto a prodotti aspecifici.

Curva di fluorescenza

Curva di melting

100

80

60

40

20

0

104 copie

3.0

2.5

2.0

1.5

1.0

0.5

0

104 copie

10 copie

0 copie

10 copie

0 copie

Fluorescenza

Fluorescenza

65 70 75 80 85 90 95

0 10 20 30 40 50

Temperatura (°C)

Cicli di amplificazione

100

80

60

40

20

0

Derivata negativa della curva di melting

Al termine della PCR la temperatura viene lentamente aumentata inducendo un decremento della fluorescenza.

La temperatura in corrispondenza della quale si ha un repentino decremento della fluorescenza corrisponde alla Tm del prodotto.

104 copie

10 copie

0 copie

prodotti non specifici

-dF/dT

TM

65 70 75 80 85 90 95

Temperatura (°C)

ANALISI della CURVA di MELTING


Pcr reazione a catena della polimerasi

Identificando il primo ciclo della PCR in corrispondenza del quale inizia l’amplificazione esponenziale del prodotto è possibile quantificare la concentrazione iniziale del DNA bersaglio.

Estrapolazione della curva standard

Curva di fluorescenza di campioni a concentrazione nota

105

106

104 copie

Fluorescenza

105

106

104 copie

linea di base

La linea di base identifica il ciclo in corrispondenza del quale inizia l’aumento esponenziale della fluorescenza per ciascun campione.

Numero cicli

Riportando in grafico il valore di intersezione con la linea di base in funzione del Log della concentrazione iniziale di ciascun campione si ottiene la curva standard da cui si può estrapolare il valore della concentrazione di campioni a titolo ignoto.

N. cicli

Log concentrazione

QUANTIFICAZIONE del PRODOTTO di PCR


Pcr reazione a catena della polimerasi

Consente l’analisi simultanea di due campioni nella stessa reazione

STRATEGIA:

Due coppie di Sonde di Ibridazione, ciascuna specifica per un prodotto di amplificazione, vengono marcate con un diverso colorante accettore che emette la fluorescenza a differenti lunghezze d’onda.

LC Red 640

LC Red 705

Fluorecseina

Fluorecseina

Canale 2

640 nm

Canale 3

705 nm

Il segnale emesso viene letto simultaneamente attraverso due canali di rilevamento fluorimetrico.

Trasferimento

Eccitazione

Emissione

MULTIPLEX PCR


Pcr reazione a catena della polimerasi

Sfrutta differenze nella Tm di Sonde di Ibridazione perfettamente legate al DNA bersaglio o il cui legame è destabilizzato dalla presenza di basi non appaiate.

gene selvatico

omozigote wildtype

Sonda 2

marcata con LC Red 640

Sonda 1

marcata con Fluoresceina

3.0

2.5

2.0

1.5

omozigote mutante

eterozigote

Fluorescenza

gene mutato

La Sonda 1 si ibridizza alla parte della sequenza bersaglio mutata

La Sonda 2 si ibridizza alla parte della sequenza bersaglio non mutata

50 55 60 65 70 75 80

Temperatura

0.25

0.20

0.15

0.10

0.05

0.00

-0.05

-dF/dT

Al termine della PCR si analizza la curva di melting: se è presente una mutazione, la Tm dell’ibrido sarà più bassa che in assenza di mutazione.

50 55 60 65 70 75 80

Temperatura

ANALISI di MUTAZIONI PUNTIFORMI


Pcr reazione a catena della polimerasi

REGOLAMENTO 258/97 sui Novel Food

Disciplina la vendita di prodotti contenenti OGM destinati al consumo umano ed introduce la nozione di sostanziale equivalenza : due alimenti sono considerati sostanzialmente equivalenti quando non presentano alcuna differenza dal punto di vista nutrizionale, organolettico e della sicurezza.

Rende inoltre obbligatoria l’etichettatura degli alimenti transgenici che non siano sostanzialmente equivalenti ai prodotti convenzionali.

REGOLAMENTI COMUNITARI 49 E 50/2000

Prevedono l’obbligo di etichettatura per tutti gli alimenti che contengano ingredienti (49/2000), additivi e aromi (50/2000) derivanti da organismi geneticamente modificati.

L’obbligo non vale se il prodotto risulti accidentalmente contaminato da derivati di organismi geneticamente modificati in una percentuale non superiore all’1%.

L’ETICHETTATURA nei REGOLAMENTI C.E.E.


Pcr reazione a catena della polimerasi

TEST sulle PROTEINE

TEST sul DNA

Rilevazione immunologica della proteina codificata dal transgene (ELISA)

Ricerca del transgene e di sequenze ad esso correlate

(Real-time PCR)

- Quali- / quantitativo

- Rapido

- Sensibile (limite = 0.0001%)

- Quali- / quantitativo

- Rapido

- Test da campo

-

Richiede materie prime non lavorate

- Degradazione del DNA

- Presenza di inibitori della polimerasi

-

L’espressione delle proteine è spesso tessuto-specifica e sviluppo-dipendente

-

Possibili contaminazioni con DNA estraneo

-

Non tutti i derivati alimentari contengono DNA (es. olio di semi di mais)

DIAGNOSTICA degli OGM negli ALIMENTI


Pcr reazione a catena della polimerasi

I° STEP

Analisi qualitativa (screening)

Rivela la presenza/assenza dell’OGM nel campione

Si ricerca la presenza di sequenze regolatrici comuni alla maggior parte degli OGM

risultato

negativo

risultato

positivo

Si identifica il transgene presente, verificando se è uno di quelli autorizzati in commercio

L’analisi si arresta

II° STEP

Nessun transgene autorizzato

Analisi quantitativa

Transgene autorizzato

Se i singoli ingredienti superano la percentuale dell’1% scatta l’obbligo di riportarne la presenza in etichetta

Alimento illegale

ITER per il RILEVAMENTO di OGM negli alimenti mediante TEST sul DNA


Pcr reazione a catena della polimerasi

Elementi caratteristici dei costrutti ricombinanti

Promotore CaMV 35S

Promotore CaMV 35S

Gene marcatore

Gene marcatore

Transgene

tNOS

tNOS

Amplificazione di una delle seguenti sequenze:

PCR QUALITATIVA

Amplificazione di geni sicuramente presenti nel campione (es. lectina della soia, zeina del mais)

(è disponibile una banca dati che contiene tutte le sequenze di DNA depositate nei brevetti a livello mondiale)

PCR QUANTITATIVA

GENI BERSAGLIO nell’analisi qualitativa degli alimenti

Individuazione del transgene


Pcr reazione a catena della polimerasi

Mais Bt

Soia Roundup Ready

Il mais-BT è stato reso resistente alla piralide mediante l’inserimento

La soia Roundup Ready (Monsanto) è stata modoficata geneticamente per resistere alla somministrazione del glifosato, un diserbante ad ampio spettro.

di un gene che codifica per una tossina insetticida

derivata dal batterio Bacillus turingiensis la cui ingestione provoca la morte delle larve paralizzandone l’intestino.

Per quantificare mais e soia transgenici negli alimenti sono state opportunamente disegnate combinazioni di Sonde di Ibridazione che riconoscono tanto il transgene quanto un gene endogeno, rendendo possibile quantificare simultaneamente sia il contenuto di mais/soia GM che di mais/soia totale nel campione in analisi.

Sonda 1 specifica per il transgene cryIA(b), codificante per la tossina

Sonda 1 specifica per il transgene CP4-EPSPS

Sonda 2 specifica per il gene endogeno codificante per l’enzima invertasi

Sonda 2 specifica per il gene endogeno codificante per la lectina

2 ESEMPI di QUANTIFICAZIONE...


  • Login