base mutations on protein function and phenotypes
Download
Skip this Video
Download Presentation
Base Mutations on Protein Function and Phenotypes

Loading in 2 Seconds...

play fullscreen
1 / 25

Base Mutations on Protein Function and Phenotypes - PowerPoint PPT Presentation


  • 81 Views
  • Uploaded on

Base Mutations on Protein Function and Phenotypes. Polypeptides made up of amino acids Proteins are polypeptides, numerous amino acids. **Notice the “R” group. It’s a group of molecules that determines the amino acid. **Peptide Bond between amino acids. First Recall Proteins------.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Base Mutations on Protein Function and Phenotypes' - clare-hinton


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
first recall proteins

Polypeptides made up of amino acids

    • Proteins are polypeptides, numerous amino acids

**Notice the “R” group. It’s a group of molecules that determines the amino acid.

**Peptide Bond between amino acids

First Recall Proteins------
amino acid sequence polypeptide

The amino acid sequence determines the protein!!

  • Shape-specific
    • Example - The sequence for a specific enzyme will be totally different from that of a hormone!

Human Growth Hormone

Amylase Enzyme

Amino Acid Sequence - Polypeptide
structural proteins

Forms part of cell materials

  • Provides support
    • fibrous and stringy and provide support. Examples: Keratins strengthen protective coverings such as hair, quills, feathers, horns, and beaks. include keratin
    • Collagen, and elastin are examples. Collagens and elastin provide support for connective tissue such as tendons and ligaments.
Structural Proteins
functional proteins

Hormones – Chemical Signals released by a cell or a gland in one part of the body that sends out messages that affect cells in other parts of the organism

      • Growth and development
      • Metabolism - how your body gets energy from the foods you eat
      • Sexual function
      • Reproduction
      • Mood
  • Enzymes – catalyze chemical reactions.
    • Example – Amylase is the enzyme that breaks starches in your mouth. Speeds up the rate of digestion.
    • Nearly all biochemical reactions require them!
Functional Proteins
mistakes can occur

Remember that DNA is replicated during the S phase of Interphase of the cell cycle and during Meiosis (the formation of gametes)

  • Mutations may or may not change the function of a protein
    • May change phenotype or how a gene is expressed
      • Example: brown hair is a phenotype, sickle cell anemia is a phenotype, dwarfism is a phenotype
Mistakes Can Occur!!
mutations

***Errors usually occur during DNA replication and transcription by external agents called mutagens (chemicals, radiation, X-rays etc.)

***Some occur randomly and some phenotypes are selected for in nature

***Although mutations can cause problems, if it weren’t for mutations, we wouldn’t have new genes such as those for green eyes

Mutations
fixing errors

Enzymes proofread as bases are paired during replication and replace those wrongly paired

  • Other enzymes police the replication process
  • But…………
“Fixing” Errors
mutations change a dna sequence and may affect a gene

May be random or spontaneous.

  • When genes have an error in their DNA code, they may not work properly, and are said to be "altered" or mutated.
  • DNA damage from environmental agents such as radiation (sunlight), nuclear radiation, some viruses, some chemicals, genetics, inflammation, infection
    • Mistakes that occur when a cell copies its DNA in preparation for cell division.
    • Can occur during meiosis (making of sperm, and egg)
    • Changes mRNA codons
Mutations Change a DNA Sequence and May Affect a Gene
slide13

Spontaneous Mutations Environmental agents such as nuclear radiation can damage DNA by breaking bonds between nucleotides on either side of the DNA molecule can occur

slide14

Mutated Cells

  • Some mutated cells will be defeated by the body\'s immune system
  • others may undergo apoptosis, or “cell suicide”.
  • occasionally a cell with mutations slips through proofreading safeguards.
  • When mutations accumulate, the genetic material is so scrambled that the cell no longer acts like a normal, healthy cell.
  • Tumors, mass of cells that have no purpose, may form
benign tumors non cancerous

Not malignant tumor (cancerous)

  • Does not invade nearby tissue or spread to other parts of the body the way cancer can.
  • But benign tumors can be serious if they press on vital structures such as blood vessels or nerves.
  • Some, such as colon polyps, can become cancerous
Benign Tumors (non-cancerous)
cancerous tumor malignant

Abnormal cells grow uncontrolled

  • Invades surrounding tissues
  • Usually capable of producing metastases (spread to other organs)
  • May recur after attempted removal
  • May cause death of the host unless adequately treated
Cancerous Tumor (malignant)
mutations and reproduction

**Mutations can occur during meiosis, the making of sperm or egg and can be passed along to offspring

**Example: Achonroplasia is a type of dwarfism that can come from a mutation during sperm formation

**The mutation may produce a new trait (good OR bad)

.

Mutations and Reproduction
types of base mutations

** Point mutations, base substitution, affects a single base

**Frameshift – Addition or deletion of a base – Affects entire protein

Types of Base Mutations
point mutations

Affects a single base and change the codon

  • May or may not affect the amino acid
    • Sometimes if the third base of the codon changes, the amino acid may stay the same!
    • UCU
    • UCC
    • UCA
    • UCG

ALL code for Ser

Point Mutations
slide21

TACCAGGATTAACATGGAAGTGTAATC

DNA

AUGGUCCUAAUUGUACCUUCACAUUAG

mRNA

Met

Met

Val

Val

Leu

Leu

Ile

Ile

Val

Pro

Pro

Ser

Ser

His

His

(STOP)

(STOP)

Leu

Base Substitution MAY or MAY NOT Change the Protein

What if the C was substituted with an A ?????

TACCAGGATTAA

AATGGAAGTGTAATC DNA

AUGGUCCUAAUU

UUACCUUCACAUUAG mRNA

REMEMBER if the 3rd base is changed, it may not change the protein!

base substitution example

Sickle Cell Anemia – red blood cells have a protein on their surgface called hemoglobin that carry oxygen. Patients with this affliction have misshaped (sickle-shaped) red blood cells and cannot carry enough oxygen

**Notice the DNA sequence below.. A is substituted for a T

Base Substitution Example
frameshift mutation

Insertion (addition) or deletion of a base shift the frame of bases left or right, changing the amino acids affecting the whole protein. It won’t function properly

Frameshift Mutation
slide24

Phe

Met

Met

Val

Val

Asp

Leu

Leu

Ile

Ile

Val

Thr

Pro

Ser

His

(STOP)

Thr

Leu Extra Base

Frame-Shift Addition

Example: Addition of a T beside of the C... shifts the entire protein over to the right– changes ENTIRE PROTEIN – There is NO STOP CODON!!

DNA

DNA

mRNA

mRNA

TACCAGGATTAACATGGAAGTGTAATC

AUGGUCCUAAUUGUACCUUCACAUUAG

TACCAGGATTAA

CTATGGAAGTGTAATC…

GAUACCUUCACAUUAG…

AUG GUC CUA AUU

slide25

Ile

His

Met

Met

Val

Val

Leu

Thr

Leu

Ile

Ile

Val

Pro

Leu

Ser

His

(STOP)

Ser or Arg

Frameshift Deletion

Example: Deletion of the C... shifts the entire protein over to the Left– changes ENTIRE PROTEIN – There is NO STOP CODON!!

DNA

DNA

mRNA

mRNA

TACCAGGATTAACATGGAAGTGTAATC

AUGGUCCUAAUUGUACCUUCACAUUAG

TACCAGGATTAA

ATGGAAGTGTAATC…

UACCUUCACAUUAG…

AUG GUC CUA AUU

ad