1 / 23

How they make a scrimillion copies of the DNA

How they make a scrimillion copies of the DNA. D3S1358. D18S51. D5S818. D7S820. D8S1179. vWA. D21S11. Amelogenin. FGA. D13S317. Find the areas of interest. In the old days, they cut before and after. D3S1358. D18S51. D5S818. D7S820. D8S1179. vWA. D21S11. Amelogenin. FGA.

chynna
Download Presentation

How they make a scrimillion copies of the DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. How they make a scrimillion copies of the DNA

  2. D3S1358 D18S51 D5S818 D7S820 D8S1179 vWA D21S11 Amelogenin FGA D13S317 Find the areas of interest

  3. In the old days, they cut before and after

  4. D3S1358 D18S51 D5S818 D7S820 D8S1179 vWA D21S11 Amelogenin FGA D13S317

  5. PCR me, ASAP! So we’ve removed the DNA from the cells, now what?

  6. P C R • PCR = Polymerase chain reaction. • Used to make scrimillions of copies of the loci of interest.

  7. bases = nucleotides

  8. CGACATGTCAT TACGTAGGCTAACTGCTACAGT GATAGCAGCGTCCGATCTAGCA

  9. C G A T C G A T

  10. C G A T C G A T

  11. C G T A C G A T

  12. C G A T G C G C C G T A T A T A C G C G A T A T

  13. C G A T G C G C C G T A T A T A C G C G A T A T

  14. C G T A G C G C C G T A T A T A C G C G A T A T

  15. This is amplification. Technically, this is not a science term either. Amplify: Root words Amplus, large + facere, to make* So we can just keep splitting it open and adding bases and make millions and millions of copies. *Webster’s New World Compact School and Office Dictionary, at 15, (1989)

  16. The loci we care about are tagged with a flourescent dye. . . Holt Science and Technology, Life Science, p. 137

More Related