Tema 5 genes e ingenier a gen tica
This presentation is the property of its rightful owner.
Sponsored Links
1 / 38

TEMA 5: GENES E INGENIERÍA GENÉTICA PowerPoint PPT Presentation


  • 55 Views
  • Uploaded on
  • Presentation posted in: General

TEMA 5: GENES E INGENIERÍA GENÉTICA. 1. ADN: el material de los genes. Empaquetamiento del ADN en un cromosoma en mitosis. Estructura de la molécula de ADN (“descubierta” en 1953 por Watson y Crik). El ADN es una doble cadena de nucleótidos , paralelas y enrolladas en hélice.

Download Presentation

TEMA 5: GENES E INGENIERÍA GENÉTICA

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Tema 5 genes e ingenier a gen tica

TEMA 5: GENES E INGENIERÍA GENÉTICA


1 adn el material de los genes

1. ADN: el material de los genes


Empaquetamiento del adn en un cromosoma en mitosis

Empaquetamiento del ADN en un cromosoma en mitosis


Estructura de la mol cula de adn descubierta en 1953 por watson y crik

Estructura de la molécula de ADN(“descubierta” en 1953 por Watson y Crik)

  • El ADN es una doble cadena de nucleótidos, paralelas y enrolladas en hélice.

  • Los nucleótidos están formados por:

    • Azúcar: desoxirribosa

    • Fósforo (P)

    • Base nitrogenada:

      • Adenina (A),

      • Timina (T),

      • Guanina (G)

      • Citosina (C)


La doble cadena estar a unida por estas bases de manera que la a se une a la t y la c a la g

La doble cadena estaría unida por estas bases, de manera que la A se une a la T y la C a la G

Por ejemplo:

AAATTATGCGTGCATTGACCTAAACCCAAATTTGACTTAC

TTTAATACGCACGTAACTGGATTTGGGTTTAAACTGAATG


Funciones del adn

Funciones del ADN

  • Si el ADN es el material del que están hechos los genes, esta molécula debe realizar las funciones que se le atribuyen a los genes:

    • Contener la información genética (o hereditaria) necesaria para realizar todas las funciones del ser vivo. Pero ¿cómo lleva la información una molécula de ADN?

    • Controlar la aparición de los caracteres o la realización de una función. Pero ¿cómo se manifiesta el carácter o se realiza la función?

    • Pasar la información de una célula a sus células hijas durante el proceso de división celular. Pero ¿cómo se copia esa información que se va a repartir?


2 el adn contiene informaci n

2. El ADN contiene información

  • La información vendrá dada porel orden de los nucleótidos (de las bases nitrogenadas)

  • Pero esta información tiene que traducirse a proteínas, que hacen un trabajo determinado y darán un carácter determinado

    ¿Cómo y dónde se hace esto?

  • El ADN no puede salir del núcleo por lo que la información se copia en una molécula de ARNm (mensajero). Está formada también por nucleótidos y la información está copiada por complementariedad: A=U, T=A, CΞG, GΞC (está molécula no posee la timina y en su lugar tiene uracilo)

    AAATTATGCGTGCATTGACCTAAACCCAAATTTGACTTAC

    TTTAATACGCACGTAACTGGATTTGGGTTTAAACTGAATG

    AAAUUAUGCGUGCAUUGACCUAAACCCAAAUUUGACUUAC (RNAm)

  • El ARNm sale al citoplasma y su información se lee y traduce en los ribosomas (el proceso se llama traducción)


Traducci n de la informaci n a prote nas

Traducción de la información a proteínas

  • Pero las proteínas están formadas por unidades llamadas aminoácidos. ¿Cómo se traduce un “lenguaje” de nucleótidos a uno de Aa?

  • La secuencia de nucleótido es leída en grupos de tres. Cada 3 nucleótidos (triplete) corresponde a 1 Aa y esa correspondencia se llama código genético.

  • Los ribosomas van identificando los tripletes y van uniendo los Aa hasta formar las proteínas


C digo gen tico

Código genético

Tercera letra

AUG CGU GCA UUG ACC UAA ACCCAA AUU CUU UGA AC (RNAm)

Metionina- Arginina- Alanina-… -Treonina- …- Treonina- Glicina- Isoleucina-…- Stop (proteína)


S ntesis de prote nas

Síntesis de proteínas


3 la informaci n contenida en el adn se copia

3. La información contenida en el ADN se copia

  • Se abre la doble cadena y delante de cada una de ellas se colocan los nucleótidos complementarios.


4 cambios en la informaci n gen tica mutaciones

4. Cambios en la información genética: mutaciones

  • Las mutaciones son errores en la copia del ADN, producidos:

    • Al azar

    • Inducidos por agentes mutagénicos:

      • Factores físicos: rayos X

      • Sustancias químicas: como sustancias que hay en el tabaco

  • Las mutaciones pueden afectar:

    • A 1 gen (génicas): es un error al copiar el ADN. Es la causa de que aparezcan alelos diferentes para 1 gen (aumentan la diversidad)

    • A 1 cromosoma (cromosómicas): es un error al repartirse los cromosomas en la mitosis o meiosis (más importante porque forma células reproductoras)


Tema 5 genes e ingenier a gen tica

  • Una mutación puede resultar:

    • Favorable: facilita la supervivencia y deja más descendencia.

    • Neutra: ni beneficia ni perjudica la descendencia (pero permanece en la población)

    • Desfavorable: los individuos que la tienen presentan problemas para sobrevivir

  • Si el medio cambia, lo que es desfavorable puede llegar a ser favorable (o viceversa). Por ej la anemia falciforme en lugares donde hay malaria (y ver diapositiva siguiente)

  • Además de las mutaciones hay otra forma de aumentar la diversidad ¿Cuál?


Ejemplo de variaci n del medio

Ejemplo de variación del medio


Resumiendo la diversidad se produce por

Resumiendo: la diversidad se produce por

REPRODUCCIÓN

Intercambio de información

Errores en la copia o reparto

Reproducción sexual

Mutaciones

Variabilidad en la descendencia


5 la ingenier a gen tica

5. La ingeniería genética

  • Conjunto de técnicas que permiten quitar, poner o modificar genes al ADN de un organismo con el fin de cambiar su información. Los genes incorporados pueden ser de la misma especie o de otra diferente.

  • Si los organismos modificados genéticamente son eucariotas, se dice que son transgénico.

  • Si los organismos modificados son procariotas (bacterias) se les suele denominar organismos genéticamente modificados (OGM)


4 los proyectos genoma

4. Los Proyectos Genoma

  • Genoma es el conjunto de genes que posee un organismo.

  • El “proyecto genoma” pretende secuenciar el ADN de una especie e identificar los genes.

  • El “Proyecto Genoma Humano” (PGH) comenzó en 1990 y se completó en abril de 2003, pero se continúa con él porque, se conoce la secuencia de nucleótidos pero se pretende interpretar la información hasta conocer la posición de los genes y su función.

  • Características del genoma humano:

    • Contiene unos 3200 millones de pares de bases

    • Solo el 2% pertenece a genes con información para fabricar proteínas (proteoma: conjunto de proteínas codificadas por un genoma). Contiene unos 25.000 genes pero se desconoce la función de casi la mitad de ellos

    • Es casi igual para todos los seres humanos. Solo nos diferencia el 0,1%

    • Casi la mitad de las proteínas humanas son muy semejantes a las de otros seres vivos.

  • Así, además de la genómica se ha iniciado una etapa proteómica o Proyecto Proteoma.


5 c mo se modifica el adn de un organismo

5¿Cómo se modifica el ADN de un organismo?


Aplicaciones de la ingenier a gen tica

APLICACIONES DE LA INGENIERÍA GENÉTICA


Tema 5 genes e ingenier a gen tica

aplicaciones médicas

  • Obtención de proteínas de interés médico, comercial, etc… (insulina, hormona del crecimiento, factores de coagulación)

  • Obtención de vacunas recombinantes (aternativa al uso de organismos patógenos inactivos)

  • Diagnóstico de enfermedades de origen genético

  • Tratamiento de enfermedades de origen génico: Terapia génica

  • …..


Terapia g nica

aplicaciones médicas

Terapia génica

  • Estrategias Terapéuticas: enviar una información a un grupo de células del organismo puede hacerse de dos formas distintas

    • Inyectando directamente el vector en el paciente (estrategia in vivo-dentro del cuerpo)

    • Inyectando el gen en células sanas del paciente que se han extraído antes mediante una biopsia (estrategia ex vivo-fuera del cuerpo).

  • ¿Qué tipo de células pueden emplearse en la terapia génica? Se pueden emplear dos tipos :

    • Células del propio paciente: estas células se modifican en el laboratorio, antes de re-inyectarlas.

    • Células Madre: Células con gran capacidad de multiplicarse y que pueden generar cualquier tipo de célula de un organismo adulto. Estas células pueden extraerse del propio paciente o proceder de cultivos mantenidos en el laboratorio.


Tema 5 genes e ingenier a gen tica

Agrobacterium

núcleo

Plásmido Ti

cromosoma

inductor de tumores

contiene oncogenes

(genes onc)

cromosoma

célula vegetal

Ingeniero genético natural tras sutitución de genes onc por genes de interés

tumores

Proliferación de hormonas crecimiento. Se forman tumores en las zonas de la lesión

Aplicaciones de la ingeniería genética

en agricultura

Vector: Se usa el plásmido de la bacteria Agrobacterium tumefaciens, que es patógena de plantas. Produce tumores

Plantas transgénicas

Transgénesis= introducción de ADN extraño en un genoma, de modo que se mantenga estable de forma hereditaria y afecte a todas las células en los organismos multicelulares.


Tema 5 genes e ingenier a gen tica

en agricultura

Aplicaciones de la ingeniería genética

  • Resistencia a herbicidas, insectos y enfermedades microbianas

    • El maíz transgénico de Novartises resistente al herbicida Basta y también es

    • resistente al gusano barrenador europeo (contiene el Gen de resistencia a la

    • toxina Bt de Bacillus thuringiensis)produce su propio insecticida

    • Problemas:La toxina Bt en las plantas transgénicas tienepropiedades

    • sustancialmentediferentes a la toxina Bt en su forma natural.

    • La toxina puede ser transmitida a través de la cadena alimenticia, un

    • efecto que nunca ha sido observado en la toxina Bt en su forma natural.

    • Larvas de especies de insectos predadores benéficos (larvas verdes de

    • crisopa) murieron cuando fueron alimentadas con el gusano barrenador

    • europeo

    • Mejora de la calidad de los productos agrícolas

    • ARROZ con enzima lactoferrina de leche humana, que puede ser

    • utilizada para mejorar las fórmulas de leche infantil. Los niños la

    • necesitan para usar eficientemente el hierro y pelear contra las

    • infecciones(Pearson, H. Nature, 26 april 2002).

    • Gold rice de Monsanto con beta caroteno de genes de narciso,

    • pigmentos que se transforman en pro-vitamina A al ser ingeridos

    • Síntesis de productos de interés comercial

    • Anticuerpos animales, interferón, e incluso elementos de un poliéster

    • destinado a la fabricación de plásticos biodegradables


Tema 5 genes e ingenier a gen tica

Aplicaciones de la ingeniería genética

en animales

Clonación de animales con función reproductora

(TRANSFERENCIA NUCLEAR DE CÉLULAS EMBRIONARIAS)


Tema 5 genes e ingenier a gen tica

Ingeniería Genética:

NUEVOS ALIMENTOS

Salmón transgénicopor

hormona de crecimiento.

Producido por AF Protein Inc. Cuenta con el promotor de la proteína de anticongelamiento de otra especie de pez. Crece de 4 a 6 veces más rápido que un salmón no transgénico.Tiene un 20% en mejoramiento de la eficiencia de conversión del alimento.

(ISB, 2001, oct; Netlink, 2000).

VACAS LECHERAS con incremento de proteínas. En Nueva Zelanda se clonaron vacas con óvulos mejorados genéticamente, para mejorar la producción del queso y crema, aumentando dos veces la kappa caseína, crucial para hacer la cuajada y de 20% más de beta caseina, que mejora la acción del cuajo

(Hoag, H. Nature, 27 enero 2003).


Tema 5 genes e ingenier a gen tica

Clonan terneros en EE UU para producir anticuerpos humanos

efe- Washington - agosto 2002 

Terneros clonados y manipulados genéticamente (fábrica de anticuerpos humanos)

genes para anticuerpos células dérmicas clonación

humanos recombinantes

Objetivo: Tratamiento de enfermedades inmunológicas

Futuro: Tratamiento de una amplia gama de enfermedades ocasionadas por bacterias y virus, como hepatitis, ántrax (utilizada como arma biológica)


Tema 5 genes e ingenier a gen tica

Clonan cerdos destinados a trasplantar sus órganos a humanos

La empresa escocesa PPL Therapeutics logra

retirar de los cerditos el gen que provoca el

rechazo en transplantes a humanos"alfa 1,3 galactosil transferasa"

Enero 2002. AP Photo/Roanoke Times, Gene Dalton (IDEAL-EFE)

Paso importante en favor del xenotrasplante (transferencia de células u órganos de una especie a otra)

Ayudará a superar la escasez de órganos humanos para hacer trasplantes de todo tipo


Tema 5 genes e ingenier a gen tica

¿Clonación humana?


Tema 5 genes e ingenier a gen tica

Repercusiones sociales

valoraciones éticas

  • Declaración Universal de Derecho Humanos y Genoma Humano de la UNESCO (1997), adoptada en 1998 por la Asamblea General de ONU (busca un balance entre una continuación en las investigaciones y la salvaguarda de los derechos humanos)

  • Frente a los múltiples beneficios de la ingeniería genética pueden surgir algunos problemas:

  • Problemas sanitariosnuevos microorganismos patógenos,efectos secundarios

  • de nuevos fármacos de diseño, etc...

  • Problemas ecológicos desaparición de especies con consecuencias desconocidas,

  • nuevos contaminaciones, etc...

  • Problemas sociales y políticos

  • Pueden crear diferencias aún más grandes entre países ricos y pobres (en el campo de la producción industrial, agrícola y ganadera),

  • El sondeo génico en personas puede llevar a consecuencias nefastas en la contratación laboral, por ejemplo, y atenta contra la intimidad a que tiene derecho toda persona (empleo, agencias de seguros, discriminación..).

  • Problemas éticos y morales


Tema 5 genes e ingenier a gen tica

16 de Febrero de 2001

Celera Genomics

Proyecto genoma humano

La secuencia del genoma es un atajo valioso: ayuda a los

científicos a encontrar los genes más fácil y rápidamente

y sienta las bases para averiguar la función de los genes

identificados

  • Beneficios médicos tras el conocimiento de la estructura de cada gen humano

  • Diagnóstico en individuos con riesgo de ser portadores del gen de alguna enfermedad

  • Marco de trabajo para el desarrollo de nuevas terapias, además de nuevas estrategias para la terapia génica

15 de Febrero de 2001

Consorcio público internacional


Dudas

DUDAS

  • ¿SI FUERA POSIBLE, A USTED LE GUSTARÍA HACERSE UN TEST GENÉTICO QUE LE DIJERA LAS ENFERMEDADES QUE SUFRIRÍA EN SU VIDA?


Tema 5 genes e ingenier a gen tica

  • Reemplazar genes defectuosos para sanar no es controversia, pero...¿introducir genes en gente saludable para ser más inteligente o transformarla en atleta, será ético?


Pero cu nto podemos avanzar

PERO:¿CUÁNTO PODEMOS AVANZAR?


Etica

ETICA

  • Algunas aplicaciones parecen claramente no éticas (armas biológicas).

  • ...y muchas preguntas no tiene una respuesta clara.


Pero al menos

PERO, al menos…

Un público informado es la mejor protección contra aplicaciones no éticas o abusos del conocimiento biológico.


  • Login