1 / 26

Welcome to Chem 434 Bioinformatics

Welcome to Chem 434 Bioinformatics. Sept 20, 2012 Review of course prerequisites Review of syllabus Review of CSULA Bioinformatics Course website. Course logistics. Course Website ( http://www.calstatela.edu/faculty/jmomand/Bioinformaticscourse.html ). Rationale for offering bioinformatics.

chas
Download Presentation

Welcome to Chem 434 Bioinformatics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Welcome to Chem 434Bioinformatics • Sept 20, 2012 • Review of course prerequisites • Review of syllabus • Review of CSULA Bioinformatics Course website

  2. Course logistics • Course Website (http://www.calstatela.edu/faculty/jmomand/Bioinformaticscourse.html)

  3. Rationale for offering bioinformatics • Need to understand how popular bioinformatics algorithms operate (Clustal W, BLAST, PSIPRED). • A programming assignment gives a taste of what it is like to be a developer.

  4. Definition of Bioinformatics • Use of computers to catalog and organize biological information into meaningful entities.

  5. Learning Outcomes • Retrieve gene sequence information from GenBank. • Use BLAST to conduct gene similarity searches. • Align multiple sequences with Clustal W software. • Predict secondary structures with PSIPRED. • Display and compare protein structures. • Write software programs that perform queries a database with a protein sequence. • Understand the theory that led to the development of scoring methods commonly used to measure sequence similarities.

  6. How is Bioinformatics Used? Bioinformatics is used to help “focus” the experiments of the benchtop scientist Bioinformatics isn’t going to replace lab work anytime soon Experimental proof is still the “Gold Standard”.

  7. Useful textbooks on the subject Beginning Python: From Novice to Professional, Apress 2008ISBN: 1-50059-982-9

  8. Bioinformatics – Why to Do It Richard Karp’s Motivation: "Find genetic basis of complex diseases so that we can develop more effective modes of treatment."

  9. Bioinformatics – How to Do It “… solving biological problems requires far more than clever algorithms: it involves a creative partnership between biologists and mathematical scientists to arrive at an appropriate mathematical model, the acquisition and use of diverse sources of data, and statistical methods to show that the biological patterns and regularities that we discover could not be due to chance." -- Richard Karp

  10. Who is Richard Karp? • UC Berkeley Professor • Recipient of • Turing Award (1985) • The Benjamin Franklin Medal in Computer and Cognitive Science (2004) • The Kyoto Prize (2008) • Turing award citation • For his continuing contributions to the theory of algorithms … most notably, contributions to the theory of NP-completeness. Karp introduced the now standard methodology for proving problems to be NP-complete which has led to the identification of many theoretical and practical problems as being computationally difficult. • Recent work on transcriptional regulation of genes, discovering conserved regulatory pathways, analyzing genetic variations in humans.

  11. Basis of molecular life sciences • Hierarchy of relationships (some exceptions): Genome Gene 1 Gene 2 Gene 3 Gene X Protein 1 Protein 2 Protein 3 Protein X Function 1 Function 2 Function 3 Function X

  12. B. A. Structure of a nucleotide within DNA

  13. The structure of DNA. 5’ACTG 3’TGAC

  14. human GCTGTCCCTCACTGTTGAATTTTCTCTAACTTCAAGGCCCATATCTGTGAAATGCT drosophila GCTATTAGT--ATCTTAAGTTTGTATTA--------GTCCTTGTTCGTAAGGCGTT

  15. B. A. OH RNA-the intermediary

  16. Reverse transcription Central Dogma of Molecular Biology

  17. The genetic code

  18. Amino acids-the building blocks of proteins

  19. F I V M L N Q E H K R D G A S T W Y C P

  20. Levels of protein structure

  21. Levels of protein structure II

  22. Sickle cell anemia

  23. Paper chromatography separation of hemoglobin peptides.

More Related