CBMB2008
This presentation is the property of its rightful owner.
Sponsored Links
1 / 73

Institute of Biomedical Sciences Academia Sinica PowerPoint PPT Presentation


  • 53 Views
  • Uploaded on
  • Presentation posted in: General

CBMB2008. III. Structure determination: Nucleic Acids. by NMR spectroscopy. Iren Wang 王怡人. Institute of Biomedical Sciences Academia Sinica. 2008. May 8. Outline. I. Nucleic acids hold diverse structures and functions a. In vitro SELEX b. Diverse structures of nucleic acids

Download Presentation

Institute of Biomedical Sciences Academia Sinica

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Institute of biomedical sciences academia sinica

CBMB2008

III. Structure determination: Nucleic Acids

by NMR spectroscopy

Iren Wang

王怡人

Institute of Biomedical Sciences

Academia Sinica

2008. May 8


Institute of biomedical sciences academia sinica

Outline

I. Nucleic acids hold diverse structures and functions

a. In vitro SELEX

b. Diverse structures of nucleic acids

II. NMR Spectroscopy for Nucleic Acid Assignment

a. The building blocks of nucleic acids

b. Resonance assignment in nucleic acids

III. Some application cases for protein-nucleic acids complexes

IV. Others (Advanced developments in NMR Spectroscopy)

a.Residual Dipolar Coupling (RDC)

b. Transverse Relaxation-Optimized Spectroscopy (TROSY)

c. Paramagnetic spin labeling


Institute of biomedical sciences academia sinica

I. Nucleic acids hold diverse structures and functions


Institute of biomedical sciences academia sinica

Postulated stem-loop diagram of the 5’ untranslated region of HIV-1HXB2 genomic RNA

Biochemistry (2008) 10, p.3283-93.

Nucleic Acids Res. (2008) May, p.1-17

Nucleic acids hold diverse functions

** the genetic information carriers

** tRNA: transporters of genetic information

mRNA: a copy of the information carried by a gene on the DNA

rRNA: a component of the ribosomes

snRNA (small nuclear RNA): important in a number of processes including RNA splicing and maintenance of the telomeres, or chromosome ends

** targets for proteins and/or drugs interaction


Institute of biomedical sciences academia sinica

In vitro SELEX (systematic evolution of ligands by exponential enrichment)

an excellent tool for finding nucleotide molecules that have a high affinity for a particular target from a random pool under specific conditions.

Three processes:

Selection of ligand sequences, Partitioning of aptamers, amplification of bound aptamers

Anal Bioanal Chem (2007) 387, p.171-82.


Institute of biomedical sciences academia sinica

Nucleic acids hold diverse structures

The possible conformations formed by poly-nucleotides in solution are flexible, “unstructured” single strands, stacked helical single strands, hairpins, regular duplexes formed by complementary strands, and a variety of aggregates between partially complementary strands, which may contain bulges, dangling ends, or stacked single stranded ends.

DNA duplexes, triplex, multi-stranded G-quadruplex structures

RNA structural elements: helices, hairpins, bulges, junctions, pseudoknots

** non-helical conformations and tertiary structure are stabilized by:

metal ions, water-mediated H-bonds, and stacking interactions

** formation of a double-stranded helix is driven by cooperative attractive hydrogen bonding and

stacking interactions

** U-turn / reversed U-turn of RNA: sharp turns in hairpin loops

** the diversity of RNA structures compared to DNA is a result of non-helical secondary structure

** non Watson-Crick base pairs are important for RNA/RNA and RNA/protein recognition


Institute of biomedical sciences academia sinica

Telomeric DNA quadruplex structures

The arrangement of hydrogen bonds between guanines in a G-tetrad

Current Opinion in Structural Biology (2003) 13, p.275-83.


Institute of biomedical sciences academia sinica

Secondary structure of the T arm and pseudoknotted acceptor arm of the tRNA-like structure of TYMV genomic RNA

Stem 2

Loop 1

Loop 1

Science (1998) 280, P.434-8.


Institute of biomedical sciences academia sinica

RNA structure

By Michael Sattler


Institute of biomedical sciences academia sinica

Proteins recognize unusual RNA structural elements

RNA structure: protein recognition

By stabilizing an adjacent interaction surface, bulges can participate in complex protein binding sites.

Structure (2000) 8, R47-R54.


Institute of biomedical sciences academia sinica

stacked

flipped-out

groove-binding

flap residues

RNA bugles as architectural and recognition motifs

Bulges: unpaired stretches of nucleotides located within one strand of a nucleic acid duplex

-sizes: vary from a single unpaired residue up to several nucleotides

Structure (2000) 8, R47-R54.


Institute of biomedical sciences academia sinica

RNA bugles as architectural and recognition motifs

Bugles stabilization by metal ions

Bugles distortions

Structure (2000) 8, R47-R54.


Institute of biomedical sciences academia sinica

Non-Watson–Crick base pairs employ non-standard H-bonds

bifurcated H-bonds

cis Watson-Crick G*A

water-mediated

open, water-mediated

Watson-Crick G*A

C-H N/O H-bond

Structure (2000) 8, R55-R65.


Institute of biomedical sciences academia sinica

II. NMR Spectroscopy for Nucleic Acid Assignment


Institute of biomedical sciences academia sinica

Nucleic acid bases, nucleosides, nucleotides

Nomenclature, structures, and atom numbering for the sugars contained in common Nucleotides.


Institute of biomedical sciences academia sinica

Labile protons

Nomenclature, structures, and atom numbering for the bases contained in common Nucleotides.


Institute of biomedical sciences academia sinica

Torsion Angles in Nucleic Acids

By Michael Sattler


Institute of biomedical sciences academia sinica

(A)

(B)

(C)

Sugar pucker, pseudorotation

A. Puckering of five-membered ring into envelope (E) and twist (T) forms.

B. Definition of sugar puckering modes

C. Pseudorotation cycle of the furanose ring in nucleosides.

NMR of Proteins and Nucleic acids (1986) by Kurt Wüthrich


Institute of biomedical sciences academia sinica

Syn/anti conformations – the χ torsion angle

NMR of Proteins and Nucleic acids (1986) by Kurt Wüthrich


Institute of biomedical sciences academia sinica

H2 H6 H8

H2’ H3’ H4’ H5’ H5’’

CH3

H1’ H5

1D 1H NMR spectrum in Nucleic Acids (in D2O)


Institute of biomedical sciences academia sinica

aromatic

imino

amino

1D 1H NMR spectrum in Nucleic Acids (in H2O)


Institute of biomedical sciences academia sinica

I (H2O)

Assignment of imino (and amino) resonances to establish base pairing

NOESY imino-imino, amino-imino

II (H2O)

Partial resonance assignment of non-exchangeable protons via NOE

connectivities to amino and/or imino protons

NOESY imino-H2/H6/H8/H5/H1’

III (D2O)

Identification of sugar proton spin systems

(mainly H1’/H2’/H2’’/H3’) (1H, 1H) COSY/TOCSY

Identification of aromatic spin systems

(Cytosine/Thymine H5/H6) (1H, 1H) COSY/TOCSY

Sequential resonance assignment

NOESY H6/H8-H1’, H6/H8-H2’H2’’

IV (D2O)

Assignment of 31P resonances and confirm/extend H3’,H4’,H5’,H5’’

assignments (1H, 31P) HETCOR/HETTOC

Flowcharts for resonance assignment in nucleic acids

A. NOE-based assignment in unlabeled nucleic acids

Progress in Nuclear Magnetic Resonance Spectroscopy (1998) 32, p.287-387.


Institute of biomedical sciences academia sinica

I (H2O)

Exchangeable proton/nitrogen correlation

2D 15N-HMQC imino 1H optimized G N1H, U N3H

amino 1H optimized C N4H2, G N2H2, A N6H2

Exchangeable proton/nitrogen sequential assignment

3D 15N-NOESY-HMQC (imino 15N edited NOESY)

imino-imino, amino-imino

3D 15N-NOESY-HMQC (amino 15N edited NOESY)

amino-imino

II (H2O)

Partial resonance assignment of non-exchangeable proton

from NOE connectivities with amino and/or imino protons

3D 15N-NOESY-HMQC (imino 15N edited NOESY)

aromatic-imino

Flowcharts for resonance assignment in nucleic acids

B. NOE-based assignment in labeled nucleic acids

Progress in Nuclear Magnetic Resonance Spectroscopy (1998) 32, p.287-387.


Institute of biomedical sciences academia sinica

(continued)

B. NOE-based assignment in labeled nucleic acids

III (D2O)

Identification of sugar proton spin systems

3D HCCH-COSY H1’-H2’

3D HCCH-RELAY H1’-H2’/H3’

3D HCCH-TOCSY

Identification of sugar carbon spin systems

2D 13C-CT-HSQC/HMQC

3D HCCH-COSY H1’-C2’

3D HCCH-RELAY H1’-C2’/C3’

3D HCCH-TOCSY H1’-C2’/C3’/C4’/C5’

Identification of proton/carbon aromatic spin systems

2D 13C-CT-HSQC/HMQC H6-C6, H8-C8, H5-C5, H2-C2

2D/3D HCCH-COSY H6-H5, H6-C6/ C5, H5-C6/ C5

Sequential resonance assignment

3D 13C-NOESY-HMQC H6/H8-H1’, H6/H8-H2’H2’’

IV (D2O)

Assignment of 31P resonances e.g. (1H, 31P) HETCOR/HETTOC

Flowcharts for resonance assignment in nucleic acids

Progress in Nuclear Magnetic Resonance Spectroscopy (1998) 32, p.287-387.


Institute of biomedical sciences academia sinica

Flowcharts for resonance assignment in nucleic acids

C. Assignment via through-bond coherence transfer in labeled nucleic acids

I (H2O)

Exchangeable proton/nitrogen correlation

2D 15N-HMQC imino 1H optimized G N1H, U N3H

amino 1H optimized C N4H2, G N2H2, A N6H2

II (H2O)

Through-bond amino/imino to non-exchangeable base proton correlations

HNCCH/HCCNH

III (D2O)

1. Through-bond H2-H8 correlations {HCCH-TOCSY/(1H,13C) HMBC}

2. Through-bond base-sugar correlations

{HCN (base) with HCN (sugar), HCNCH,

HCNH, {HCN (sugar) with H8N9(H8)C8H8},

{HCN (sugar) with (Hb,Hb) HSQC},

{(H1’, C8/6) HSQC with (H8/6, C8/6) HSQC}

3. Through-bond sugar correlations

{HCCH-COSY/ HCCH-TOCSY}

4. Sequential resonance assignment via through-bond

sugar-phosphate backbone correlations (1H, 13C, 31P)

HCP/ PCH/ PCCH-TOCSY/ HPHCH

Progress in Nuclear Magnetic Resonance Spectroscopy (1998) 32, p.287-387.


Institute of biomedical sciences academia sinica

NOE-based assignment in unlabeled nucleic acids


Institute of biomedical sciences academia sinica

10

15

20

1

5

5'–CGACGATGACGTCATCGTCG-3'

3'-GCTGCTACTGCAGTAGCAGC-5'

8G

H

5G

10

5

1

20

15

H

H

H

N

O

N

17G

N

H

G

N

C

N

H

11G

b

2G

N

N

R

O

N

H

R

imino proton

H

H

7T

Me

H

N

O

H

N

15T

N

12T

A

T

N

H

N

H

a

N

N

R

H

O

R

18T

imino proton

I. Assignment of imino (and amino) resonances in H2O

Imino Proton Assignments by 2D NOESY spectrum

J. Chin. Chem. Soc. (1999) 46, p.699-708.


Institute of biomedical sciences academia sinica

1

H

H8

H5

H

N

O

N

N

H6

G

N

C

N

H

N

N

R

O

N

H

R

6

H

5

7

3

H

Me

H

N

O

H8

4

N

2

N

A

T

N

H

N

H6

N

N

R

H2

O

R

II. NOESY imino-H2/H6/H8/H5/H1’ in H2O

Imino Proton to Amino to Aromatic Protons

d. Aromatic to H2’/H2”

b. Imino to amino/aromatic

c. Amino to aromatic

a. Imino to imino


Institute of biomedical sciences academia sinica

b. Imino to amino/aromatic

H5

H

H8

H5

H

N

O

N

N

H6

G

N

C

N

H

N

N

R

O

N

H

R

H

H

Me

H

N

O

H8

N

H2

N

A

T

N

H

N

6H

N

N

R

H2

O

R

II. NOESY imino-H2/H6/H8/H5/H1’ in H2O

Imino Proton to Amino and Aromatic

J. Chin. Chem. Soc. (1999) 46, p.699-708.


Institute of biomedical sciences academia sinica

III. Identification of aromatic spin systems in D2O

Only intra-strand aromatic to aromatic connectivities

J. Chin. Chem. Soc. (1999) 46, p.699-708.


Institute of biomedical sciences academia sinica

Cytosine: CH5-CH6

III. Sequential resonance assignment in D2O

NOESY H6/H8-H1’, H6/H8-H2’H2’’

JMB (1983) 171, p.319-36.

Duplex-hairpin 5'–CGCGTATACGCG-3'

Nucleic Acids Res. (1985) 13, p.3755-72.


Institute of biomedical sciences academia sinica

III. Sequential resonance assignment in D2O

NOESY H6/H8-H1’

Only intra-residue cross peaks were marked.

a-f. are the six big CH5-CH6 cross peaks.

J. Chin. Chem. Soc. (1999) 46, p.699-708.


Institute of biomedical sciences academia sinica

III. Sequential resonance assignment in D2O

NOESY H6/H8-H2’H2’’

Only intra-residue cross peaks were marked.

J. Chin. Chem. Soc. (1999) 46, p.699-708.


Institute of biomedical sciences academia sinica

2 3 4 5 6 7 8 9 10 11

5’ G-p-C-p-G-p-A-p-T-p-A-p-G-p-A-p-G-p-C-p-G

G-p-C-p-G-p-A-p-G-p-A-p-T-p-A-p-G-p-C-p-G 5’

b)

7p

6A

7G

11 10 9 8 7 6 5 4 3 2

2C

3p

3G

5T

6A

6p

8A

9G

2C

2p, 5p, 9p

4A

5T

1G

11G

11p

10C

9G

10p

10C

31P

Phosphate buffer

7G

8A

8p

4A

4p

3G

1H-31P Correlation Spectrum

(n-1) H3'- (n) P

(n) P - (n) H4'

JACS (1992) 114, 3114-5.


Institute of biomedical sciences academia sinica

NOE-based and via through-bond coherence transfer assignment in labeled nucleic acids


Institute of biomedical sciences academia sinica

Transcription

dTrA

dCrG

dGrC

dArU

DNA

RNA

Transcription starting

T7 polymerase

DNA template

3’ ATTATGCTGAGTGATATCCTTATACTATGTAAACTAGTCATATAGG 5’

5’ TAATACGACTCACTATAG 3’

Top strand

3’

5’

RNA synthesized GGAUUAUGAUACAUUUGAUCAGUAUAUCC

RNA synthesis by in vitro transcription

RNA samples at natural isotopic abundance and enriched in 15N and 13C can be prepared with T7 RNA polymerase.


Institute of biomedical sciences academia sinica

Heteronuclear Chemical Shifts in Nucleotides

Current Protocols in Nucleic Acid Chemistry (2000) 7.7.1-7.7.30


Institute of biomedical sciences academia sinica

2D 15N–1H HMQC spectra of RNA imino resonances at different conditions

PNAS (1997) 94, p.2139-44.


Institute of biomedical sciences academia sinica

The 1H-13C HSQC spectra of labeled nucleic acids

(A) H6/H8-C6/C8, (B) H1’-C1’, (C) H2’/H2’’-C2’, and (D) H3’-C3’


Institute of biomedical sciences academia sinica

H2-H8 or H5-H6

correlation

H1’,H2’, H3’ H4’H5’H5”

correlations, HCCH-TOCSY

H8-H1’ correlation, HCN

Intraresidue correlation

via through-bond coherence transfer NMR experiments

Adenine

Nucleotide spin system


Institute of biomedical sciences academia sinica

Correlation in the base-sugar: HCN 3D spectra

2D and 3D TROSY-HCN for obtaining ribose base and intra-base correlations in the nucleotides of DNA and RNA.

Dotted arrows indicate the intra-base transfers and solid arrows the ribose-base transfers.

H6/H8

H1’

JACS. 2001, 123, 658-64.


Institute of biomedical sciences academia sinica

3D HCCH-TOCSY

H1’

Progress in Nuclear Magnetic Resonance Spectroscopy (1998) 32, p.287-387


Institute of biomedical sciences academia sinica

H3’-C3’-P(n-1)

Residue n

H5’,H5’’(n-1)-C5’(n-1)-P(n-1)

Interresidue correlation through bond (HCP)

2 spin systems can be linked

Adenine

Guanine

OH

Progress in Nuclear Magnetic Resonance Spectroscopy (1998) 32, p. 287-387


Institute of biomedical sciences academia sinica

the connectivity between 1H3(U329) and the 1H2-13C2 (A32)

JNN HNN-COSY

JHN HSQC

3D13C-NOESY

1H2 (A) to 15N1(A) and 15N3(A)

Direct observation of H-bonds in nucleic acid base pairs by inter-nucleotide 2JNN couplings

1H3-15N3(U) to 15N1(A)

JACS. (1998) 120, 8293-7.


Institute of biomedical sciences academia sinica

3’

5’

Distance constraints (NOEs)

Dihedral angles constraints (J-coupling)

Distance geometry calculator

(XPLOR-NIH)

3’

5’

Structural Determination of Nucleic Acids by NMR

  • Similar to those used in protein

  • First build a nucleic acid sequence template

  • Input H-bonded constraints

  • Input all exchangeable and non-exchangeable distance constraints and/or dihedral constraints

  • Use Distance Geometry calculation to get some initial structures

  • Use Molecular Dynamics method to refine the structures


Institute of biomedical sciences academia sinica

III. Some application cases for protein-nucleic acids complexes


Institute of biomedical sciences academia sinica

NMR spectroscopy as a tool for secondary structure determination of large RNAs.

Annu. Rev. Biophys. Biomol. Struct. (2006) 35,p.319-42.


Institute of biomedical sciences academia sinica

The structure of HCV IRES domain II

Dependence of RDC values on the orientation of the interdipolar vector (C-H) and the alignment tensor

Refinement of the HCV IRES domain II structures calculated by the use of different sets of RDCs

Rmsd = 7.48Å

Rmsd = 5.79Å

Rmsd = 2.18Å

Annu. Rev. Biophys. Biomol. Struct. (2006) 35,p.319-42.


Institute of biomedical sciences academia sinica

Helix-turn-helix (HTH) domain

Zinc-finger (ZF) domain

The common DNA recognition motifs

By Dr. Song Tan


Institute of biomedical sciences academia sinica

S204

Chemical shift change plot based on NMR titration data

N-

C-

a3

Recognition helix

N196

a1

G213

E172

N196

S204

G213

Wing

a2

E172

The common DNA recognition motifs

Winged-helix (WH) domain


Institute of biomedical sciences academia sinica

The common RNA recognition motifs

RNP: ribonucleoprotein

RRM: RNA-recognition motif

RNP/RRM domain

Structure (1997) 5, p.559-70.


Institute of biomedical sciences academia sinica

The common RNA recognition motifs

The KH domains

KH: K-homology motif

Structure (1999) 7, p.191-203.


Institute of biomedical sciences academia sinica

Structure of the HIV-1 Nucleocapsid protein with SL3 C-RNA recognition element

Science (1998) 279, p. 384-8.


Institute of biomedical sciences academia sinica

Structure of the HIV-1 Nucleocapsid protein with SL3 C-RNA recognition element

Science (1998) 279, p. 384-8.


Institute of biomedical sciences academia sinica

The best fit superposition and space-filling representation of the SL3 RNA in the NC-SL3 complex

Science (1998) 279, p. 384-8.


Institute of biomedical sciences academia sinica

Recognition of the mRNA AU-rich element by the zinc finger domain of TIS11d

(a) The ensemble of best 20 structures superposed on backbone heavy atoms in ordered regions of the protein and RNA. (b) Ribbon representation of a single structure with the addition of green side chains for the zinc-coordinating ligands. (c) Backbone superposition of the structure ensembles of fingers 1 and 2. Finger 1 (Arg153–Phe180) is dark blue (backbone), green (zinc coordinating side chains) and red (intercalating aromatic rings); the bound RNA (U6, A7, U8, U9) is orange. The corresponding colors for finger 2 are light blue, yellow, pink and yellow.

NSMB (2004) 11, p. 257-64.


Institute of biomedical sciences academia sinica

Comparison between nucleolin RBD12-sNRE complex and the other RBD-RNA complexes

RBD: RNA biding domain

EMBO J (2000) 19, p.6870-81.


Institute of biomedical sciences academia sinica

IV. Advanced developments in NMR Spectroscopy


Institute of biomedical sciences academia sinica

or

New Techniques in NMR Spectroscopy

(1). Residual Dipolar Coupling (RDC)

(2). Transverse Relaxation-Optimized Spectroscopy (TROSY)

(3). Other Applications

NOE, dihedral angle and H-bond are short-range restraints and have limitations for some structure determination, like extended structures or multiple-domain structure. RDC is a novel restraint and provides global structure information.

TROSY, which was developed by K. Wüthrich, can select one fourth of the signals that relax more slowly than the others.

The utilization of TROSY techniques push the size limit of NMR spectroscopy to 30~50 kDa.

Paramagnetic Spin Labeling.


Institute of biomedical sciences academia sinica

Residual dipolar couplings arise from dipole-dipole interactions between nuclei. In aqueous solution, the isotropic orientation of the molecules average out the dipolar couplings. However, in oriented media, the molecular tumbled anisotropically. The order of 10-4 to 10-3 of anisotropy tuned the dipolar coupling constant to be a residual value of few Hz, which are well detectable by NMR spectroscopy.

Residual Dipolar Coupling (RDC)

Values of static dipolar coupling constant of two-spin systems in protein backbone


Institute of biomedical sciences academia sinica

So, Bo , DAB

S (order parameter) ,DAB

Residual Dipolar Coupling (RDC)

The residual dipolar coupling between two spins A and B are given by :

<DAB> = - C(Bo) [ a(3cos2 -1) + 3/2 r(sin2 cos2) ]

where

C(Bo) = S(Bo2/15kT)[AB h/(4p2rAB3).

A and B are gyromagnetic ratios of A and B.

rAB is the distance between A and B.


Institute of biomedical sciences academia sinica

Alignment Media

  • Phages (Pf1, fd, TMV) (Zweckstetter, JBNMR)

  • Bicelles (Sanders & Schwonek, Biochemistry, 1992; Ottiger&Bax, JBNMR 1998)

  • Polyacrylamide gels (Tycko,JBNMR; Grzesiek JBNMR; Chou, JBNMR)

  • Paramagnetic tagging (Opella, Griesinger, Byrd)

  • CPBr/hexanol (Barrientos, J. Mag. Res, ~2000)

  • C12E5/hexanol (Ruckert&Otting, JACS 2000)

  • Cellulose crystallites (Matthews, JACS, ~2000)


Institute of biomedical sciences academia sinica

Alignment of Molecules in Anisotropic Solutions

The most-used media for RDC measurement are :

(a). Phospholipid bicelles and (b). Filamentous phage


Institute of biomedical sciences academia sinica

1H Chemical Shift (ppm)

Isotropic solution

+ 5.3 mg/ml Pf1

15N Chemical Shift (ppm)

15N-IPAP HSQC for HN RDC values

JNH

JNH + DNH


Institute of biomedical sciences academia sinica

1H Chemical Shift (ppm)

Isotropic solution

+ 5.3 mg/ml Pf1

13C Chemical Shift (ppm)

3D HNCO for C’N RDC values

JC’N + DC’N

JC’N


Institute of biomedical sciences academia sinica

X

Z

Y

Structure Refinement with RDC Restraints

<DAB>(q,f) = Da [ a(3cos2 -1) + 3/2 Dr(sin2 cos2) ]


Institute of biomedical sciences academia sinica

15N

1H

Transverse Relaxation-Optimized Spectroscopy (TROSY)

(c). TROSY-HSQC

(b). Decoupled HSQC

(a). None-decoupled HSQC

  • Main relaxation source for 1H and 15N: dipole-dipole (DD) coupling and, at high magnetic fields, chemical shift anisotropy (CSA).

  • Different relaxation rates (line width) for each of the four components of 15N-1H correlation.

  • The narrowest peak (the blue peak) is due to the constructive canceling of transverse relaxation caused by chemical shift anisotropy (CSA) and by dipole-dipole coupling at high magnetic field.

  • TROSY selectively detect only the narrowest component (1 out of 4).


Institute of biomedical sciences academia sinica

DD + CSA

(large) (large)

DD – CSA

(large) (large)

Interference between DD and CSA Relaxation

  • At High Magnetic Field

  • (TROSY line-narrowing effect)

DD+CSA

(large) (small)

(B) At Low Magnetic Field

(almost no TROSY

line-narrowing effect)

DD – CSA

(large) (small)

  • DD relaxation is field-independent. However, CSA relaxation  B02,

  • therefore at high magnetic fields, CSA relaxation can be comparable to

  • DD relaxation, and the interference effect on relaxation can be observed.


Institute of biomedical sciences academia sinica

800 (kDa)

Linewidth

150 kDa

50 kDa

Magnetic field strength

TROSY Effect is Field Dependent and Motion Dependent

  • Optimal field strength: 1 GHz for amide NH;

  • 600 MHz for CH in aromatic moieties (500-800 MHz applicable).


Institute of biomedical sciences academia sinica

Deuteration- NMR structural study of larger proteins

Deuteration is also an important techniques for NMR study of larger proteins (> 20kDa). It is achieved by raising the E. coli. in D2O medium (NT$ 10,000 / 1L D2O).

Because of the significantly lower gyromagnetic ratio of 2H compared to 1H (g[2H] / g[1H] = 0.15), replacement of protons with deuterons removes contributions to proton linewidths from proton-proton dipolar relaxation and 1H-1H scalar couplings.

The effect of deuteration is similar with that of TROSY and both techniques are frequently used for NMR study of larger proteins.


Institute of biomedical sciences academia sinica

The Sensitivity and Resolution Gain by TROSY and Deuteration

2H,15N-Gyrase-45 (45 kDa), 750 MHz

Current Opinion in Structural Biology (1999) 9, p,594-601.


Institute of biomedical sciences academia sinica

MTSL

Paramagnetic Relaxation Enhancement (PRE)

Paramagnetic spin labeling


  • Login