1 / 49

HIV Drug Resistance Training

HIV Drug Resistance Training. Module 3: Principles of PCR and HIVDR Sequencing. Topics. Isolation and Amplification of DNA Sequencing Identifying Mixtures Lab Procedures. Objectives. Describe the PCR process.

cahil
Download Presentation

HIV Drug Resistance Training

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. HIV Drug Resistance Training Module 3: Principles of PCR and HIVDR Sequencing

  2. Topics • Isolation and Amplification of DNA • Sequencing • Identifying Mixtures • Lab Procedures

  3. Objectives • Describe the PCR process. • Describe the importance of maintaining the genetic diversity originally present in the sample. • Identify lab procedures that maintain the genetic diversity of the sample. • Identify lab procedures that can maximize the accuracy of genotyping results by minimizing factors that might limit accuracy.

  4. isolation and amplification of dna How is the genetic sequence isolated and reproduced in large enough quantities for testing? Why is it important to maintain the genetic diversity of the sample?

  5. HIV RNA Isolation Lysis buffer Virus sample (plasma, DBS, etc) Viral RNA and proteins Plasma proteins, lipids, etc. RNAses Affinity purification Purified viral RNA

  6. gag pol env 5’ 3’ AAAAAA Amplification of PR/RT Sequences: RT-PCR Overview Reverse primer Forward primer

  7. T G A A A G C C A C G T G T C T RT Reaction: First Strand ComplimentaryDNA (cDNA) Synthesis Viral RNA 5’ 3’ A G U C A U C G C U A C G G A C U A G G C U U C G G A U C G G A G C C T A G C C 5’ primer 3’ dNTPs Reverse transcriptase (e.g. MLV)

  8. 5’ 3’ A G U C A U C G C U A C G G A C U A G G C U U C G G A U C G G RT Reaction: First Strand Complimentary DNA (cDNA) Synthesis T C A G T A G C C A T G C C T G A T C C G A A G C C T A G C C 5’ primer 3’

  9. PCR Reaction: Second Strand DNA Synthesis T G A A A G C C A C G T dNTPs G 3’ T primer C 5’ A G T C A T C G C T C A G T A G C C A T G C C T G A T C C G A A G C C T A G C C 5’ 3’ Thermostable DNA polymerase (e.g. Taq)

  10. PCR Reaction: Second Strand DNA Synthesis 3’ primer 5’ A G T C A T C G C T A C G G A C T A G G C T T C G G A T C G G T C A G T A G C C A T G C C T G A T C C G A A G C C T A G C C 5’ 3’ Thermostable DNA polymerase (e.g. Taq)

  11. PCR Reaction: Amplification of Patient Virus PR/RT Sequences 5’ 3’ A G T C A T C G C T A C G G A C T A G G C T T C G G A T C G G Heat denaturation (95°C) T C A G T A G C C A T G C C T G A T C C G A A G C C T A G C C 5’ 3’

  12. PCR Reaction: Amplification of Patient Virus PR/RT Sequences 5’ 3’ A G T C A T C G C T A C G G A C T A G G C T T C G G A T C G G A G C C T A G C C 3’ 5’ 5’ 3’ A G T C A T C G C T C A G T A G C C A T G C C T G A T C C G A A G C C T A G C C 3’ 5’

  13. 5’ 5’ 3’ 3’ A G T C A T C G C T A C G G A C T A G G C T T C G G A T C G G A G T C A T C G C T A C G G A C T A G G C T T C G G A T C G G T C A G T A G C C A T G C C T G A T C C G A A G C C T A G C C T C A G T A G C C A T G C C T G A T C C G A A G C C T A G C C 5’ 5’ 3’ 3’ PCR Reaction: Amplification of Patient Virus PR/RT Sequences

  14. Thermal Cycling: ExponentialCopy Number Amplification Denaturation (95°C) Primer annealing (50-65°C) Primer extension (72°C)

  15. "Nested" PCR (In-house Assays Only) gag pol env 5’ 3’ AAAAAA Reverse primer 2 Forward primer 2 2nd round PCR product Reverse primer 1 Forward primer 1 1st round PCR product Pro: increased sensitivity/specificity Cons: increased chance of amplification bias; additional manipulation required

  16. Dependence of Sensitivity of Detection of Minor Variants and Input Viral Load Assume that 200 µl plasma used for RNA extraction, 25% used for RT-PCR; RT successful for 20% of RNA molecules; minority variant present at 30% of total *assuming 20% sensitivity of assay

  17. Representative Sampling 50% mixture R+S *e.g. number of amplifiable cDNA molecules in PCR reaction

  18. Representative Sampling 25% mixture R+S *e.g. number of amplifiable cDNA molecules in PCR reaction

  19. AAAAA AAAAA AAAAA AAAAA AAAAA RT-PCR and "Quasi-species" AAAAAAAAA AAAAAAAAA AAAAAAAAA AAAAAAAAA AAAAAAAAA AAAAAAAAA AAAAAAAAA viral RNA 57%/14%/14%/14% DNA for sequencing 60%/0%/20%/20% DNA copies (PR andRT) from the virus RNA

  20. Discussion • How is the genetic sequence isolated and reproduced in large enough quantities for testing? • Why is it important to maintain the genetic diversity of the sample?

  21. sequencing What is the purpose of sequencing reactions? What data is produced in sequencing reactions?

  22. Sequencing Reactions: Overview PR 1 RT 1 RT 240+ Total region length 900- 1200 bases Reaction 1 Reaction 2 Reaction 3 Reaction 4 Reaction 5 Reaction 6 Sequencing reactions (4 to 6) are performed to cover the entire region. Approximately 600 bases are detected from each reaction. Reaction components are DNA, primer, polymerase, deoxynucleotides, dideoxynocleotides, and buffer.

  23. Sequencing Reaction: DNA Denaturation Double stranded DNA (PCR products) 95° C

  24. Sequencing Reaction: Primer Annealing 1 2 Each primer is in a separate reaction tube 3 4 5 6

  25. Sequencing Reaction: Primer Extension Utilizes Taq Polymerase to bulid complementary DNA strand

  26. Sequencing Reaction: Chain Termination Fluorescently-labeled dideoxynucleotide triphosphate (ddNTP)

  27. T T A A G G G G T T A G C C A A T T Automated basecalling is performed by the analyzer. T A C G T G G A T T A C A T G G A T D Y V Y M D 183 184 185 183 184 185 Sequencing: Electrophoresis

  28. Sequencing Data Analysis

  29. Dye-primer Sequencing (TruGene®) • Dye-labeled primers used instead of labeled di-deoxy NTPs • Primers labeled with one of 2 dyes • A forward and reverse labeled primer used in a reaction with one of the (unlabeled) di-deoxy NTPs

  30. ABI Sequencing Instruments

  31. Alternative Sequencing Instruments Beckman CEQ8000 TruGene

  32. Discussion • What is the purpose of sequencing reactions? • What data is produced in sequencing reactions?

  33. primer design How is the sequence of PCR and sequencing primers determined? What approaches can be used to design primers that work across multiple subtypes of HIV?

  34. primer 5’ 3’ A G T C A T C G C T C A G T A G C C A T G C C T G A T C C G A A G C C T A G C C 5’ 3’ PCR Primers: General Guidelines • Flanking region of interest plus >~50 nt spacer • 15-25 nt long • G-C base pair at 3' end if possible • Compatible melting temperatures • Avoid self-complimentary sequences at 3' end (lead to primer dimers) AGTGACTCGCTAGCGC AGTGACTCGCTAGCGC

  35. Sequencing Primers PR 1 RT 1 RT 240+ • Flanking region of interest plus >~20 nt spacer • Evenly distributed across target sequence, ~400-500 nt apart • 15-20 nt long

  36. Cross-subtype primer design • Both PCR and sequencing primers should bind to regions that are conserved across subtypes • Avoid mismatches near the 3' end in particular • Where necessary, incorporate degenerate bases (e.g. R or Y) or synthesize alternate primers and mix together in defined ratio SEQ1 ACGTATCGATCTCTGATTATACTGCATCGATATACGATACTATC SEQ2 -----------A---------------T---------------- SEQ3 ---------C-C-------------------------A------ SEQ4 --------G--C-------------------------------- SEQ5 -----------C---------------T---------A------ SEQ6 --------GC---A-------------T---------------- Forward primer CTGATTATACTGCATYGATATACG

  37. Pairs Activity: Primer Design

  38. identifying mixtures What is base calling? What are some of the challenges of base calling?

  39. Guidelines for Base-Calling • Automated base-calling is not 100% accurate • Accuracy decreases in areas of poor quality, high background, or artifacts such as "dye blobs" • Discrimination between "true" and "false" mixtures • General requirements: • Overlapping sequence derived from both strands (sense and anti-sense primers) • Short regions of single-stranded coverage may be acceptable if high quality, and subject to supervisor's review • Take local signal to noise ratio and patterns into account

  40. Examples of Mixtures Mixture at 184 – M/V

  41. Examples of Mixtures

  42. Examples of Mixtures

  43. Discussion • What is base calling? • What are some of the challenges of base calling?

  44. lab procedures What lab practices will help contribute to accuracy of HIVDR genotyping?

  45. Discussion • Why is it importance to maintain the genetic diversity originally present in the sample? • In general, what lab procedures can maximize the accuracy of genotyping results by minimizing factors that might limit accuracy?

  46. Reflection • What do we need to do to make sure our lab has good procedures in place to ensure the accuracy of the test?

  47. Summary • Isolation and Amplification of DNA • Sequencing • Identifying Mixtures • Lab Procedures

More Related