Comparative genomics analysis of NtcA regulons in cyanobacteria: Regulation of nitrogen assimilation...
Download
1 / 31

Wen-Ting Huang Jau-Chi Huang - PowerPoint PPT Presentation


  • 200 Views
  • Uploaded on

Comparative genomics analysis of NtcA regulons in cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis. Wen-Ting Huang Jau-Chi Huang. Zhengchang Su, Vitctor Olman, Fenglou Mao and Ying Xu. Outline. Introduction Method Result Conclusion. Introduction.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Wen-Ting Huang Jau-Chi Huang' - breck


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Comparative genomics analysis of NtcA regulons in cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

Wen-Ting Huang

Jau-Chi Huang

Zhengchang Su, Vitctor Olman, Fenglou Mao and Ying Xu


Outline
Outline cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

  • Introduction

  • Method

  • Result

  • Conclusion


Introduction
Introduction cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

  • DNA transcription

  • mRNA

5’

3’

5’

3’

coding region

coding region

intron


5’ cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

3’

5’

3’

Regulation elements

RNA polymerase

5’

3’

Regulatory region

RNA polymerase binding site

upstream

downstream

transcription direction


  • cis-regulation cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

    • Regulatory regions of genes and the regulated genes are on the same chromosome

  • Phylogenetic footprinting

    • Identifies regulatory elements by finding regions in a set of orthologous non-coding DNA sequences from multiple species.


  • Cyanobacteria cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

    • bacteria

    • live in the water

    • Gram-Negative, oxygenic phototrophs

    • Nitrogen control in cyanobacteria is mediated by NtcA

http://www.ucmp.berkeley.edu/bacteria/cyanointro.html


  • NtcA cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

    • A protein which regulates the assimilation of nitrogen.

  • NtcA binding site

    • Base Motif “GTAN8TAC”

    • ~14 bps

    • Intron

    • Nitrogen fixation related genes

    • -31 downstream has -10 σ70like box “TAN3T”


High false positive rate
High false positive rate cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

  • Too short to identify

  • 3 methods:

    • Coding region

    • -10 like box

    • Othologous genes


Materials
Materials cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

  • Nine sequenced cyanobacteria genomes were downloaded from the GenBank.

  • ftp.ncbi.nih.gov/genomes/Bacteria/


Method
Method cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

  • Step 1:

    • Prepare training sets

    • Get the profiles(GTAN8TAC, TAN3T)

  • Step 2:

    • Scan genomic sequences and score each motif.

  • Step 3:

    • Decide the cutoff.


Known
Known cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

  • Possible NtcA binding sites (GTAN8TAC)

    • Appear in the upstream intergenic regions

    • In many cases, there is a –10 like box (TAN3T) in the 31bp downstream regions of the NtcA binding site

upstream

transcription unit

transcription unit

31bp


Prepare training sets
Prepare training sets cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

  • They chose 11 genes which are known to be regulated by NtcA from the nine cyanobacterial genomes.

  • They used phylogenetic footprinting and identified 51 putative NtcA binding sites.

  • These 51 sites constitute the training set A1 for the NtcA binding site.

  • The –31 bp downstream regions are further searched for a –10 like box and form the training set B1


A1 b1
A1 & B1 cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis


A2 b2
A2&B2 cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

  • They collected 12 experimentally verified NtcA binding sites and their downstream from seven other cyanobacteria.

  • They also included the sites that failed to find by phylogenetic footprinting.


Profiles
Profiles cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

  • They combined A1 and A2 to construct the profile of NctA binding sites.


Profiles1
Profiles cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

  • They combined B1 and B2 to construct the profile of –10 like boxes.


Scan genomic sequences
Scan genomic sequences cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

upstream

transcription unit

transcription unit

GTAAAGTTAAGTTCCTTCAAAGCATTCGTGG

TTAAAGTTAAGTTCTTTTAAAGCTTTCGTGG


Scan genomic sequences1
Scan genomic sequences cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

upstream

transcription unit

transcription unit

GTAAAGTTAAGTTCCTTCAAAGCATTCGTGG

TTAAAGTTAAGTTCTTTTAAAGCTTTCGTGG


The scoring functions
The scoring functions cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis


Orthologous genes
Orthologous genes cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

  • The presence of similar motifs in the regulatory regions of the orthologous genes can increase the prediction accuracy.

  • They predicted two genes in two genomes to be orthologous to each other if they are a pair of reciprocal best hit in BLASTP searches.


Orthologous genes1
Orthologous genes cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

upstream

transcription unit


Cutoff
Cutoff cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

  • The largest score for the genome to include all the binding sites from that genome in the training sets.

  • P-value

    • p[S(CU)>sc]<0.01 or 0.05


Analysis
Analysis cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis


Analysis1
Analysis cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

“GTA________TAC”

“TA___T”


Niche of ntca in cyanobacteria
Niche of NtcA in cyanobacteria … ? cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

  • Some genes bear NtcA promoters might coordinate photosynthesis and nitrogen fixation.

  • RNA polymerase σ-factor in cyanobacteria might bear an NtcA promoter and regulated by NtcA.


Conclusion
Conclusion cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis

  • The false positive rate is reduced from 8.2 to 90.9 fold.

  • Some binding sites might be missed due to the lack of orthologues in the other genomes.

  • NtcA promoters are found for many genes involved in the various stages of photosynthesis process.


Thank You cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis


ad