440 likes | 637 Views
Targeting duplex DNA: strategies and applications Maxim Frank-Kamenetskii mfk@bu.edu Boston University reprints at: http://www.bu.edu/cab. How can we sequence-specifically target the DNA duplex?. H DNA. Triplex . Displaced strand. Triplex . Displaced strand . 1985. base triads.
E N D
Targeting duplex DNA: strategies and applicationsMaxim Frank-Kamenetskiimfk@bu.eduBoston Universityreprints at:http://www.bu.edu/cab
H DNA Triplex Displaced strand Triplex Displaced strand 1985
base triads Hoogsteen pairing Watson-Crick pairing Hoogsteen pairing Watson-Crick pairing
The DNA double helix major groove minor groove
Old-fashioned single-molecule experiment JMB 1993 JMB 1993
PNA PNA – A DNA Mimic with Unique Properties DNA Peptide Nucleic Acidcarries is the same bases as DNA (red), but has a totally different protein-like backbone (blue) Nielsen et al. 1991
PNA features Neutral backbone • Stronger and faster binding to nucleic acids • High sequence-specificity • No nucleic acid no degradation by nucleases • No peptide no degradation by protease Strand invasion into duplex DNA
FISH of telomeres using PNA Peter Lansdorp (University of British Columbia, Canada)
PNA FISH for bacterial detection Staphylococcus aureus (green) AdvanDx Inc. , Woburn, MA
PNA openers Triplex Invasion Double Duplex Invasion Homopyrimidine PNA Pseudocomplementary pcPNA any base composition
base triads Hoogsteen pairing Watson-Crick pairing Hoogsteen pairing Watson-Crick pairing
A pair of pseudocomplementary PNAs (pcPNAs) invade into the DNA double helix in a strictly sequence-specific manner PNAS 2004
dsDNA Triplex Invasion Complex “ P-loop “ H2N-Lys-CCTCTCTT Example: linker H-Lys2-JJTJTJTT J C C+ H H H N H H H H C H H R N R N N N N H H H H H H N N+ H O O O H N N N N O R R H H N N N N O O H o o g s t e e n H o o g s t e e n G G H H N N N N N N pairing pairing R R H H W W a a t t s s o o n n - - C C r r i i c c k k pairing pairing Triplex Invasion into Duplex DNA by PNA “Openers” Homopurine site within dsDNA PNA “opener”: Two homopyrimidine PNA oligomers connected by a flexible linker (bis-PNA) + ++ J bases eliminate pH dependence of triplex invasion C*G:C (pH5) J*G:C (pH7)
PNA openers = 6-10 5' 3' NH2 COOH 3' 5' PD-loop 3' 5' N=4-10 Targeting duplex DNA through PD-loop • Two PNA openers are able to sequence-specifically hybridize to complementary target sites in duplex DNA • DNA probe can hybridize to the displaced strand forming a stable complex PNAS 1998
Capturing duplex DNA using PD-loop Capturing a fragment from the entire yeast genome PD-loop PNAS 1998
Hybridization/extension of primer Hybridization/circularization of oligonucleotide Hybridization of DNA or PNA beacon “Artificial primosome” . . . . . . . . . . . . . . . . . . . . . . . . . . . “Earring Probe” . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . DNA sequencing, Ligand Mapping F Q Assembly of novel DNA structures, DNA diagnostics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . DNA detection PNA openers and some of their applications dsDNA bis-PNA openers homopyrimidine sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Locally open dsDNA
Molecularbeacons JACS 2002
PNA openers ligand DNA polymerase Nascent DNA strand DNA polymerase pausing due to drug binding to dsDNA JMB 2003
Mapping drug’s binding sites on dsDNA via artificial primosome PNA II PNA I
New methods of DNA-based detection AEM 2007 BMC 2007
E.coli B.subtilis S.mutans Proof-of-principle studies on bacterial cells chosen signature sites: 21-nt-target site in E.coli cold shock protein gene GGAGAGAGACTCAAAAGAAGG 23-nt-target site in B.subtilis the phosphoglycerate dehydrogenase gene GAAAAGAAACCCTTCAGAGGAAG 22-nt-target site in S.mutans the wall-associated protein gene AAAAGAGGTATTTTAAGAGGAA (PNA binding sites are underlined) These sites are unique for each of the bacteria throughout the Bacterial Genomes Database AEM 2007
Solid-state nanopore NanoLetters 2010
PNA openers Triplex Invasion Double Duplex Invasion Homopyrimidine PNA Pseudocomplementary pcPNA any base composition
g-PNA ArtDNA 2010
Capturing duplex DNA using PD-loop Capturing a fragment from the entire yeast genome PD-loop PNAS 1998
Affinity capture using g-PNA: linear dsDNA ArtDNA 2010
Affinity capture using g-PNA: supercoiled DNA (scDNA) ArtDNA 2010
Acknowledgements • Boston University • Irina Smolina • Heiko Kuhn • Nancy Miller • Amit Meller and his group • Harvard Medical School • Charles Lee • US Genomics • Katya Protozanova • Gary Jaworski • Rhea Mahabir • Copenhagen University • Peter Nielsen • Carnegie Mellon University • Danith Ly • Funding: • Wallace H. Coulter Foundation. • NIH