Targeting duplex DNA:
Download
1 / 38

How can we sequence-specifically target the DNA duplex? - PowerPoint PPT Presentation


  • 114 Views
  • Uploaded on

Targeting duplex DNA: strategies and applications Maxim Frank-Kamenetskii [email protected] Boston University reprints at: http://www.bu.edu/cab. How can we sequence-specifically target the DNA duplex?. H DNA. Triplex .  Displaced strand. Triplex . Displaced strand . 1985. base triads.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' How can we sequence-specifically target the DNA duplex?' - boris


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Targeting duplex DNA: strategies and applicationsMaxim [email protected] Universityreprints at:http://www.bu.edu/cab



H dna
H DNA

Triplex 

 Displaced strand

Triplex 

Displaced strand 

1985


Base triads
base triads

Hoogsteen pairing

Watson-Crick pairing

Hoogsteen pairing

Watson-Crick pairing


The dna double helix
The DNA double helix

major groove

minor groove



Pna as a tool for targeting duplex dna

PNA as a tool for targeting duplex DNA


PNA

PNA – A DNA Mimic with Unique Properties

DNA

Peptide Nucleic Acidcarries is the same bases as DNA (red), but

has a totally different protein-like backbone (blue)

Nielsen et al. 1991


Pna features
PNA features

 Neutral backbone

  • Stronger and faster binding to nucleic acids

  • High sequence-specificity

  • No nucleic acid  no degradation by nucleases

  • No peptide  no degradation by protease

Strand invasion into duplex DNA



FISH of telomeres using PNA

Peter Lansdorp (University of British Columbia, Canada)


PNA FISH for bacterial detection

Staphylococcus aureus (green)

AdvanDx Inc. , Woburn, MA


Pna openers
PNA openers

Triplex

Invasion

Double Duplex

Invasion

Homopyrimidine PNA

Pseudocomplementary

pcPNA

any base composition


Base triads1
base triads

Hoogsteen pairing

Watson-Crick pairing

Hoogsteen pairing

Watson-Crick pairing


A pair of pseudocomplementary PNAs (pcPNAs) invade into the DNA double helix in a strictly sequence-specific manner

PNAS 2004


dsDNA DNA double helix in a strictly sequence-specific manner

Triplex Invasion Complex

“ P-loop “

H2N-Lys-CCTCTCTT

Example:

linker

H-Lys2-JJTJTJTT

J

C

C+

H

H

H

N

H

H

H

H

C

H

H

R

N

R

N

N

N

N

H

H

H

H

H

H

N

N+

H

O

O

O

H

N

N

N

N

O

R

R

H

H

N

N

N

N

O

O

H

o

o

g

s

t

e

e

n

H

o

o

g

s

t

e

e

n

G

G

H

H

N

N

N

N

N

N

pairing

pairing

R

R

H

H

W

W

a

a

t

t

s

s

o

o

n

n

-

-

C

C

r

r

i

i

c

c

k

k

pairing

pairing

Triplex Invasion into Duplex DNA by PNA “Openers”

Homopurine site within dsDNA

PNA “opener”: Two homopyrimidine PNA oligomers connected by a flexible linker (bis-PNA)

+

++

J bases eliminate pH dependence of triplex invasion

C*G:C (pH5)

J*G:C (pH7)


Targeting duplex dna through pd loop

PNA openers = 6-10 DNA double helix in a strictly sequence-specific manner

5'

3'

NH2

COOH

3'

5'

PD-loop

3'

5'

N=4-10

Targeting duplex DNA through PD-loop

  • Two PNA openers are able to sequence-specifically hybridize to complementary target sites in duplex DNA

  • DNA probe can hybridize to the displaced strand forming a stable complex

PNAS 1998


Capturing duplex dna using pd loop
Capturing duplex DNA using PD-loop DNA double helix in a strictly sequence-specific manner

Capturing a fragment from the entire yeast genome

PD-loop

PNAS 1998


Applications of pna openers

Applications of PNA openers DNA double helix in a strictly sequence-specific manner


Hybridization/extension of primer DNA double helix in a strictly sequence-specific manner

Hybridization/circularization

of oligonucleotide

Hybridization of DNA or

PNA beacon

“Artificial primosome”

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

“Earring Probe”

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

DNA sequencing,

Ligand Mapping

F

Q

Assembly of novel DNA

structures, DNA diagnostics

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

DNA detection

PNA openers and some of their applications

dsDNA

bis-PNA openers

homopyrimidine sequence

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

Locally open dsDNA


Molecular beacons
Molecular DNA double helix in a strictly sequence-specific mannerbeacons

JACS 2002


Dna polymerase pausing due to drug binding to dsdna

PNA openers DNA double helix in a strictly sequence-specific manner

ligand

DNA polymerase

Nascent DNA strand

DNA polymerase pausing due to drug binding to dsDNA

JMB 2003


Mapping drug s binding sites on dsdna via artificial primosome
Mapping drug’s binding sites on dsDNA via DNA double helix in a strictly sequence-specific mannerartificial primosome

PNA II

PNA I


Dna detection using pna openers

DNA detection DNA double helix in a strictly sequence-specific mannerusing PNA openers


Pd loop as a tool for detection of short signature sites

PD-loop as a tool DNA double helix in a strictly sequence-specific mannerfor detection of short signature sites


New methods of DNA-based detection DNA double helix in a strictly sequence-specific manner

AEM 2007

BMC 2007


E.coli DNA double helix in a strictly sequence-specific manner

B.subtilis

S.mutans

Proof-of-principle studies on bacterial cells

chosen signature sites:

21-nt-target site in E.coli cold shock protein gene

GGAGAGAGACTCAAAAGAAGG

23-nt-target site in B.subtilis the phosphoglycerate dehydrogenase gene

GAAAAGAAACCCTTCAGAGGAAG

22-nt-target site in S.mutans the wall-associated protein gene

AAAAGAGGTATTTTAAGAGGAA

(PNA binding sites are underlined)

These sites are unique for each of the bacteria throughout the Bacterial Genomes Database

AEM 2007


Potential application viral dna detection
Potential Application:Viral DNA Detection DNA double helix in a strictly sequence-specific manner


Solid-state DNA double helix in a strictly sequence-specific mannernanopore

NanoLetters 2010


NanoLetters 2010 DNA double helix in a strictly sequence-specific manner


Duplex DNA labeling using nicking enzymes DNA double helix in a strictly sequence-specific manner

NAR 2008


Pna openers1
PNA openers DNA double helix in a strictly sequence-specific manner

Triplex

Invasion

Double Duplex

Invasion

Homopyrimidine PNA

Pseudocomplementary

pcPNA

any base composition


g DNA double helix in a strictly sequence-specific manner-PNA

ArtDNA 2010


Capturing duplex dna using pd loop1
Capturing duplex DNA using PD-loop DNA double helix in a strictly sequence-specific manner

Capturing a fragment from the entire yeast genome

PD-loop

PNAS 1998


Affinity capture using DNA double helix in a strictly sequence-specific mannerg-PNA:

linear dsDNA

ArtDNA 2010


Affinity capture using DNA double helix in a strictly sequence-specific mannerg-PNA:

supercoiled DNA (scDNA)

ArtDNA 2010


Acknowledgements
Acknowledgements DNA double helix in a strictly sequence-specific manner

  • Boston University

  • Irina Smolina

  • Heiko Kuhn

  • Nancy Miller

  • Amit Meller and his group

  • Harvard Medical School

  • Charles Lee

  • US Genomics

  • Katya Protozanova

  • Gary Jaworski

  • Rhea Mahabir

  • Copenhagen University

  • Peter Nielsen

  • Carnegie Mellon University

  • Danith Ly

  • Funding:

  • Wallace H. Coulter Foundation.

  • NIH


ad