Targeting duplex DNA:
This presentation is the property of its rightful owner.
Sponsored Links
1 / 38

How can we sequence-specifically target the DNA duplex? PowerPoint PPT Presentation


  • 90 Views
  • Uploaded on
  • Presentation posted in: General

Targeting duplex DNA: strategies and applications Maxim Frank-Kamenetskii [email protected] Boston University reprints at: http://www.bu.edu/cab. How can we sequence-specifically target the DNA duplex?. H DNA. Triplex .  Displaced strand. Triplex . Displaced strand . 1985. base triads.

Download Presentation

How can we sequence-specifically target the DNA duplex?

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


How can we sequence specifically target the dna duplex

Targeting duplex DNA: strategies and applicationsMaxim [email protected] Universityreprints at:http://www.bu.edu/cab


How can we sequence specifically target the dna duplex

How can we sequence-specifically target the DNA duplex?


H dna

H DNA

Triplex 

 Displaced strand

Triplex 

Displaced strand 

1985


Base triads

base triads

Hoogsteen pairing

Watson-Crick pairing

Hoogsteen pairing

Watson-Crick pairing


The dna double helix

The DNA double helix

major groove

minor groove


How can we sequence specifically target the dna duplex

Old-fashioned single-molecule experiment

JMB 1993

JMB 1993


Pna as a tool for targeting duplex dna

PNA as a tool for targeting duplex DNA


How can we sequence specifically target the dna duplex

PNA

PNA – A DNA Mimic with Unique Properties

DNA

Peptide Nucleic Acidcarries is the same bases as DNA (red), but

has a totally different protein-like backbone (blue)

Nielsen et al. 1991


Pna features

PNA features

 Neutral backbone

  • Stronger and faster binding to nucleic acids

  • High sequence-specificity

  • No nucleic acid  no degradation by nucleases

  • No peptide  no degradation by protease

Strand invasion into duplex DNA


How can we sequence specifically target the dna duplex

PNA/DNA duplexes are more stable than DNA/DNA duplexes


How can we sequence specifically target the dna duplex

FISH of telomeres using PNA

Peter Lansdorp (University of British Columbia, Canada)


How can we sequence specifically target the dna duplex

PNA FISH for bacterial detection

Staphylococcus aureus (green)

AdvanDx Inc. , Woburn, MA


Pna openers

PNA openers

Triplex

Invasion

Double Duplex

Invasion

Homopyrimidine PNA

Pseudocomplementary

pcPNA

any base composition


Base triads1

base triads

Hoogsteen pairing

Watson-Crick pairing

Hoogsteen pairing

Watson-Crick pairing


How can we sequence specifically target the dna duplex

A pair of pseudocomplementary PNAs (pcPNAs) invade into the DNA double helix in a strictly sequence-specific manner

PNAS 2004


How can we sequence specifically target the dna duplex

dsDNA

Triplex Invasion Complex

“ P-loop “

H2N-Lys-CCTCTCTT

Example:

linker

H-Lys2-JJTJTJTT

J

C

C+

H

H

H

N

H

H

H

H

C

H

H

R

N

R

N

N

N

N

H

H

H

H

H

H

N

N+

H

O

O

O

H

N

N

N

N

O

R

R

H

H

N

N

N

N

O

O

H

o

o

g

s

t

e

e

n

H

o

o

g

s

t

e

e

n

G

G

H

H

N

N

N

N

N

N

pairing

pairing

R

R

H

H

W

W

a

a

t

t

s

s

o

o

n

n

-

-

C

C

r

r

i

i

c

c

k

k

pairing

pairing

Triplex Invasion into Duplex DNA by PNA “Openers”

Homopurine site within dsDNA

PNA “opener”: Two homopyrimidine PNA oligomers connected by a flexible linker (bis-PNA)

+

++

J bases eliminate pH dependence of triplex invasion

C*G:C (pH5)

J*G:C (pH7)


Targeting duplex dna through pd loop

PNA openers = 6-10

5'

3'

NH2

COOH

3'

5'

PD-loop

3'

5'

N=4-10

Targeting duplex DNA through PD-loop

  • Two PNA openers are able to sequence-specifically hybridize to complementary target sites in duplex DNA

  • DNA probe can hybridize to the displaced strand forming a stable complex

PNAS 1998


Capturing duplex dna using pd loop

Capturing duplex DNA using PD-loop

Capturing a fragment from the entire yeast genome

PD-loop

PNAS 1998


Applications of pna openers

Applications of PNA openers


How can we sequence specifically target the dna duplex

Hybridization/extension of primer

Hybridization/circularization

of oligonucleotide

Hybridization of DNA or

PNA beacon

“Artificial primosome”

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

“Earring Probe”

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

DNA sequencing,

Ligand Mapping

F

Q

Assembly of novel DNA

structures, DNA diagnostics

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

DNA detection

PNA openers and some of their applications

dsDNA

bis-PNA openers

homopyrimidine sequence

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

Locally open dsDNA


Molecular beacons

Molecularbeacons

JACS 2002


Dna polymerase pausing due to drug binding to dsdna

PNA openers

ligand

DNA polymerase

Nascent DNA strand

DNA polymerase pausing due to drug binding to dsDNA

JMB 2003


Mapping drug s binding sites on dsdna via artificial primosome

Mapping drug’s binding sites on dsDNA via artificial primosome

PNA II

PNA I


Dna detection using pna openers

DNA detectionusing PNA openers


Pd loop as a tool for detection of short signature sites

PD-loop as a tool for detection of short signature sites


How can we sequence specifically target the dna duplex

New methods of DNA-based detection

AEM 2007

BMC 2007


How can we sequence specifically target the dna duplex

E.coli

B.subtilis

S.mutans

Proof-of-principle studies on bacterial cells

chosen signature sites:

21-nt-target site in E.coli cold shock protein gene

GGAGAGAGACTCAAAAGAAGG

23-nt-target site in B.subtilis the phosphoglycerate dehydrogenase gene

GAAAAGAAACCCTTCAGAGGAAG

22-nt-target site in S.mutans the wall-associated protein gene

AAAAGAGGTATTTTAAGAGGAA

(PNA binding sites are underlined)

These sites are unique for each of the bacteria throughout the Bacterial Genomes Database

AEM 2007


Potential application viral dna detection

Potential Application:Viral DNA Detection


How can we sequence specifically target the dna duplex

Solid-state nanopore

NanoLetters 2010


How can we sequence specifically target the dna duplex

NanoLetters 2010


How can we sequence specifically target the dna duplex

Duplex DNA labeling using nicking enzymes

NAR 2008


Pna openers1

PNA openers

Triplex

Invasion

Double Duplex

Invasion

Homopyrimidine PNA

Pseudocomplementary

pcPNA

any base composition


How can we sequence specifically target the dna duplex

g-PNA

ArtDNA 2010


Capturing duplex dna using pd loop1

Capturing duplex DNA using PD-loop

Capturing a fragment from the entire yeast genome

PD-loop

PNAS 1998


How can we sequence specifically target the dna duplex

Affinity capture using g-PNA:

linear dsDNA

ArtDNA 2010


How can we sequence specifically target the dna duplex

Affinity capture using g-PNA:

supercoiled DNA (scDNA)

ArtDNA 2010


Acknowledgements

Acknowledgements

  • Boston University

  • Irina Smolina

  • Heiko Kuhn

  • Nancy Miller

  • Amit Meller and his group

  • Harvard Medical School

  • Charles Lee

  • US Genomics

  • Katya Protozanova

  • Gary Jaworski

  • Rhea Mahabir

  • Copenhagen University

  • Peter Nielsen

  • Carnegie Mellon University

  • Danith Ly

  • Funding:

  • Wallace H. Coulter Foundation.

  • NIH


  • Login