Antibiotics and genetic variation in bacteria

1. Antibiotics and genetic variation in bacteria

2. Objectives • Antibiotics • Antibiotics don’t work against viruses.  • Antibiotics may be used to treat bacterial disease. One way, in which antibiotics function is by preventing the formation of bacterial cell walls, resulting in osmotic lysis. • Genetic variation in bacteria • DNA is the genetic material in bacteria as well as in most other organisms. • Mutations are changes in DNA and result in different characteristics. • Mutations in bacteria may result in resistance to antibiotics. • Resistance to antibiotics may be passed to subsequent generations by vertical gene transmission. • Resistance may also be passed from one species to another when DNA is transferred during conjugation. This is horizontal gene transmission. • Antibiotic resistance in terms of the difficulty of treating tuberculosis and MRSA.

3. Natural selection • Survival of the fittest • Individuals vary • Individuals who are best suited to the environment survive to reproduce and pass on their genes.

4. Causes of variation in bacteria • Mutation • conjugation

5. mutation • A change to the DNA of a gene • Can change the amino acid sequence • This could give an altered protein

6. Types of mutation • DNA base sequence can be changed by: • Original sequence: CAT CATCATCATCATCATCATCAT • A deletion: CAT CTA CTACTACTACTACTACTA • An addition: CAT CAT TCA TCATCATCATCATCA • A substitution CAT CAT GAT CAT CATCATCATCAT

7. Animation Mcgraw Hill -conjugation

8. Vertical and horizontal gene transmission

9. Antibiotics • chemicals that act against bacteria. • Often they stop or slow the bacterial cells from reproducing by binary fission • Antibiotics may be used to treat bacterial disease. • Example-penicillin

10. How do antibiotics work? • prevent important cross linkages between peptides in bacterial cell walls from forming causing them to be weak. • In water the lower water potential inside the bacterium causes inward movement of water molecules by osmosis. • the bacterium will swell and burst (Lysis will occur) destroying the cell.

11. Antibiotic resistance • A chance mutation occurred • Bacterium able to grow in the presence of penicillin. • It had become resistant to it. • the bacterium is clearly at an advantage with this gene. • This means that the resistant bacterium will survive and pass on its resistance gene from one generation to the next-vertical gene transmission. • The resistant form would now be selected for in the presence of penicillin so the frequency of the gene will increase in the population. • As the gene for resistance to penicillin is found on a plasmid it could also be passed from cell to cell by conjugation-horizontal gene transmission.

12. Antibiotic halos around antibiotic discs. Only bacteria resistant to the antibiotic can grow up to disc.

13. Treating infections like TB • The susceptable bacteria are killed first • The remaining bacteria are likely to be the ones with most resistance to the antibiotic. • The resistant strains survive and are more likely to be spread to other people. • The selection pressure promotes the resistant strains. • These strains can pass the resistant genes to other species during conjugation.

15. Treating TB • Take antibiotics for 6-9 months • Patients with TB are given a cocktail of several different antibiotics to ensure that at least one is effective. • Patients may have to report to a clinic to be observed taking their medication.

16. MRSA and antibiotics • Most people carry Staphylococcus on skin/throats • Staphylococcus infections can be treated with antibiotics. • MRSA occurs when the strain of Staphylococcus is resistant to one or more antibiotics. • MRSA infections are a problem in hospitals

17. Issues • Antibiotics are no longer prescribed for slight infections • Antibiotics should not be used to treat viral infections • Patients should take the whole course of antibiotics. • Antibiotics are used by farmers to reduce disease and hence improve productivity