slide1
Download
Skip this Video
Download Presentation
Abstract #137

Loading in 2 Seconds...

play fullscreen
1 / 1

Abstract #137 - PowerPoint PPT Presentation


  • 90 Views
  • Uploaded on

Molecular networks regulated by tumor suppressive microRNA-375 in head and neck squamous cell carcinoma . Abstract #137. Takashi Kinoshita 1,2 , Toyoyuki Hanazawa 1 , Nijiro Nohata 1,2 , Naoko Kikkawa 1 , Miki Fuse 2 , Takeshi Chiyomaru 3 ,

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Abstract #137' - blaise


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Molecular networks regulated by tumor suppressive microRNA-375 in head and neck squamous cell carcinoma

Abstract #137

Takashi Kinoshita1,2, Toyoyuki Hanazawa1, Nijiro Nohata1,2, Naoko Kikkawa1, Miki Fuse2, Takeshi Chiyomaru3,

Hirofumi Yoshino3, Hideki Enokida3, Masayuki Nakagawa3, Yoshitaka Okamoto1, Naohiko Seki2

1Department of Otorhinolaryngology / Head and Neck Surgery, Graduate School of Medicine, Chiba University, Chiba Japan

2Department of Functional Genomics, Graduate School of Medicine, Chiba University, Chiba, Japan

3Department of Urology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima, Japan

Background and Aims

Top 10down-regulated miRNAs

from TaqMan LDA in HSCC

Top 10down-regulated miRNAs

from TaqMan LDA in MSSCC

miR-375 expression in

20 pairs of HNSCC samples

miR-375 inhibited cancer cell proliferation and induced apoptosis

MicroRNAs (miRNAs) constitute a class of small non-protein coding RNA molecules, 19 – 22 nucleotides in length. They negatively regulate multiple genes by mRNA cleavage or translational repression. Down-regulated miRNAs in cancer cells could function as a tumor suppressors by negatively regulating oncogenes. Our miRNA expression signatures of hypopharyngeal squamous cell carcinoma (HSCC), maxillary sinus squamous cell carcinoma (MSSCC) and esophageal squamous cell carcinoma (ESCC) revealed that microRNA-375 (miR-375) was significantly down-regulated in cancer tissues compared to normal epithelium.

The aim of this study was to clarify the functional significance of miR-375 and to identify the gene targets miR-375 regulates in head and neck squamous cell carcinoma (HNSCC).

P=0.008

SAS

miR-375 expression

(Normalized to RNU48)

1.6

* P<0.0001

1.4

100

2.5

*

*

1.2

80

2.0

1.0

60

1.5

0.8

Early apoptosis cell

(relative to mock)

Cell proliferation

(% of mock)

0.6

40

1.0

0.4

20

0.5

0.2

0

0

0

control

control

mock

miR-375

mock

miR-375

Normal

Tumor

Key Findings

miR-375 directly regulates MTDH expression

both in mRNA and protein levels

Top 20 down-regulated genes by transfection of miR-375

in HNSCC cell lines

Knocking down of MTDH inhibited cancer cell proliferation

  • 1. qRT-PCR revealed that miR-375 was down-regulated in HNSCC tissues compared with adjacent normal epithelium in 20 patients with HNSCC.
  • 2. Gain-of-function analysis revealed that cancer cell proliferation was inhibited and apoptosis was induced in miR-375 transfected HNSCC cells.
  • 3. Genome-wide molecular targets search and TargetScan database indicated that LDHB (lactate dehydrogenase B) and MTDH (metadherin) were candidate genes of miR-375target.
  • 4. qRT-PCR, Western blots, and luciferase assays revealed that miR-375 directly inhibits LDHB and MTDH expression.
  • LDHB, which is the glycolytic enzyme that catalyze the formation of lactic acid from pyruvate, promotes cell proliferation in HNSCC.
  • MTDH, which promotes tumorigenesis by modulating multiple signal transduction pathways such as NF- κB, PI3K/AKT, and Wnt pathway, promotes cell proliferation in HNSCC.

SAS

120

MTDH(NM_178812) 3’UTR length:1637

* P<0.0001

100

miR-375 target site

1454-1460

80

*

MTDH mRNA expression

(% of mock)

60

* P<0.0001

40

SAS

5‘ ...ACUAGGAAAGCUAAACGAACAAA...              |||    ||||||| 3’     AGUGCGCUCGGCUUGCUUGUUU

Position 1454-1460

of MTDH 3’UTR

20

100

0

5‘ ...ACUAGGAAAGCUAAA-------A...              |||    ||||||| 3’     AGUGCGCUCGGCUUGCUUGUUU

80

Position 1454-1460

deletion

*

*

mock

miR-375

control

Cell proliferation

(% of mock)

60

1.2

* P<0.0001

40

MTDH

1.0

20

β-Actin

*

0.8

Luminescence

(normalized)

120

0.6

0

100

0.4

80

0.2

60

MTDH normalized

to β-Actin

mock

si-MTDH_1

si-MTDH_2

si-control

40

0

20

WT-3’UTR

DEL-3’UTR

0

mock

control

miR-375

miR-375 directly regulates LDHB expression

both in mRNA and protein levels

The mRNA expression of candidate genes for miR-375 target

in 20 pairs of HNSCC samples

Knocking down of LDHB inhibited cancer cell proliferation

HERPUD1

PSIP1

SLC7A11

LDHB(NM_002300) 3’UTR length:201

LDHB

MTDH

IMC-3

0.30

P=0.12

P=0.16

P=0.38

P=0.014

P=0.015

160

0.18

miR-375 target site

171-177

0.20

0.10

Conclusions

0.16

0.020

140

0.25

* P<0.0001

0.14

120

0.08

0.20

0.15

0.015

0.12

IMC-3

miR-375 functions as a tumor suppressor in HNSCC. LDHB and MTDH are directly regulated by miR-375. These genes may function as oncogenes and contributed to cell proliferation in HNSCC. Tumor suppressive miR-375 and its target oncogenes may provide new insights into the molecular networks of HNSCC.

100

LDHB mRNA expression

(% of mock)

Normalized to GAPDH

Normalized to GAPDH

Normalized to GAPDH

Normalized to GAPDH

0.10

0.06

0.15

Normalized to GAPDH

80

0.010

0.10

0.08

5\' ...GCAAUCUGAGCUCUU-GAACAAAU...             ||||     ||||||  3\'     AGUGCGCUCGGCUUGCUUGUUU 

Position 171-177

of LDHB 3\' UTR

0.10

60

0.04

* P<0.0001

120

0.06

*

0.005

40

0.04

0.05

0.05

0.02

0.02

100

*

*

20

0

0

5\' ...GCAAUCUGAGCUCUU--------U...             ||||     ||||||  3\'     AGUGCGCUCGGCUUGCUUGUUU 

Position 171-177

deletion

0

0

0

0

Tumor

Normal

Tumor

Normal

Normal

Tumor

80

Normal

Tumor

Normal

Tumor

mock

miR-375

control

Cell proliferation

(% of mock)

60

* P<0.0001

References

1.2

LDHB

40

1.0

  • Tumor suppressive microRNA-375 regulates oncogene AEG-1 /MTDH in head and neck squamous cell carcinoma (HNSCC) Journal of Human Genetics, 2011 56:595-601.
  • Tumor suppressive microRNA-375 regulates lactate dehydrogenase B in maxillary sinus squamous cell carcinoma International Journal of Oncology, 2012 40:185-93.

GAPDH

0.8

20

Luminescence

(normalized)

0.6

120

*

0

0.4

100

80

0.2

LDHB normalized

to GAPDH

mock

si-control

si-LDHB_1

si-LDHB_2

60

0

40

WT-3’UTR

DEL-3’UTR

20

mock

control

miR-375

0

ad