Frameshift
This presentation is the property of its rightful owner.
Sponsored Links
1 / 4

*** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment PowerPoint PPT Presentation


  • 83 Views
  • Uploaded on
  • Presentation posted in: General

Frameshift. *** CTGGGAGATTATGGCTTTAAG*** *** CTGGGA- - - - - - - - - - -TAAG*** 11 bp deletion, alignment. *** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment. Leu Gly Asp Tyr Gly Phe Lys Leu Gly STOP G translation.

Download Presentation

*** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Ctg gga gat tat ggc ttt aag ctg gga taa g codon alignment

Frameshift

*** CTGGGAGATTATGGCTTTAAG***

*** CTGGGA- - - - - - - - - - -TAAG*** 11 bp deletion, alignment

*** CTG GGA GAT TAT GGC TTT AAG

*** CTG GGA TAA G codon alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly STOP G translation


Ctg gga gat tat ggc ttt aag ctg gga taa g codon alignment

Silent

*** CTG GGA GAT TAT GGC TTT AAG***

*** CTG GGA GAT TAT GGC TTC AAG*** alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly Asp Tyr Gly Phe Lys translation


Ctg gga gat tat ggc ttt aag ctg gga taa g codon alignment

Missense

*** CTG GGA GAT TAT GGC TTT AAG***

*** CTG GGA GAT TAT GGC TAT AAG***alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly Asp Tyr Gly Tyr Lys translation


Ctg gga gat tat ggc ttt aag ctg gga taa g codon alignment

Nonsense

*** CTG GGA GAT TAT GGC TTT AAG***

*** CTG GGA GAT TAG GGC TTT AAG***alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly Asp STOP translation


  • Login