1 / 4

*** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment - PowerPoint PPT Presentation

  • Uploaded on

Frameshift. *** CTGGGAGATTATGGCTTTAAG*** *** CTGGGA- - - - - - - - - - -TAAG*** 11 bp deletion, alignment. *** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment. Leu Gly Asp Tyr Gly Phe Lys Leu Gly STOP G translation.

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
Download Presentation

PowerPoint Slideshow about ' *** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment ' - betha

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript



*** CTGGGA- - - - - - - - - - -TAAG*** 11 bp deletion, alignment


*** CTG GGA TAA G codon alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly STOP G translation



*** CTG GGA GAT TAT GGC TTC AAG*** alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly Asp Tyr Gly Phe Lys translation



*** CTG GGA GAT TAT GGC TAT AAG*** alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly Asp Tyr Gly Tyr Lys translation



*** CTG GGA GAT TAG GGC TTT AAG*** alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly Asp STOP translation
