Sponsored Links
This presentation is the property of its rightful owner.
1 / 4

*** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment PowerPoint PPT Presentation

  • Uploaded on
  • Presentation posted in: General

Frameshift. *** CTGGGAGATTATGGCTTTAAG*** *** CTGGGA- - - - - - - - - - -TAAG*** 11 bp deletion, alignment. *** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment. Leu Gly Asp Tyr Gly Phe Lys Leu Gly STOP G translation.

Download Presentation

*** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript

Ctg gga gat tat ggc ttt aag ctg gga taa g codon alignment



*** CTGGGA- - - - - - - - - - -TAAG*** 11 bp deletion, alignment


*** CTG GGA TAA G codon alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly STOP G translation

Ctg gga gat tat ggc ttt aag ctg gga taa g codon alignment



*** CTG GGA GAT TAT GGC TTC AAG*** alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly Asp Tyr Gly Phe Lys translation

Ctg gga gat tat ggc ttt aag ctg gga taa g codon alignment



*** CTG GGA GAT TAT GGC TAT AAG***alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly Asp Tyr Gly Tyr Lys translation

Ctg gga gat tat ggc ttt aag ctg gga taa g codon alignment



*** CTG GGA GAT TAG GGC TTT AAG***alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly Asp STOP translation

  • Login