AUUCCGAUGGCAUUUUGCAAAUGAGAG

1. Identify the amino acids that make up the protein listed in the mRNA sequence below. AUUCCGAUGGCAUUUUGCAAAUGAGAG

2. Does the DNA sequence ever get messed up? Yes, it does. When this happens, we call it a mutation. A mutation is a change in the nucleotide sequence of DNA. And as you can probably guess, a change in DNA leads to a change in mRNA, which can lead to a change in protein synthesis.

3. Some mutations can be harmful or even fatal to an organism. Sickle-cell anemia is caused by a mutation to a single base pair in the DNA that codes for hemoglobin. (Remember that hemoglobin is a protein that carries oxygen in red blood cells.)

4. This mutation causes the mRNA to change from GAA to GUA. The amino acid valine would be added to the protein instead of glutamic acid. This change results in an abnormal form of hemoglobin that causes red blood cells to have a sickle, or crescent, shape. The sickle-shaped cells cannot flow well through narrow blood vessels, resulting in a variety of health problems.

5. Some types of mutations affect more than one codon. For instance, a mutation can cause one or more nucleotides to be added to or deleted from DNA. This type of mutation can lead to the production of a completely different protein. As a result, the mutation can be harmful, or even fatal to the organism.

6. We can think about the DNA sequence of a gene as a sentence made up entirely of three-letter words. In the sequence, each three-letter word is a Codon, specifying a single amino acid in a Protein. Have a look at this sentence: Thesunwashotbuttheoldmandidnotgethissunhat If you were to split this sentence into individual three-letter words, what would it look like?

7. Thesunwashotbuttheoldmandidnotgethissunhat codon codon codon codon codon codon codon codon codon codon codon codon codon codon This sentence represents a gene. Each letter corresponds to a nucleotide base, and each word represents a codon. The sun was hot but the old man did not get his sun hat

8. What if you shifted the three-letter "reading frame?" Thesunwashotbuttheoldmandidnotgethissunhat T hes unw ash otb utt heo ldm and idn otg eth iss unh at or Th esu nwa sho tbu tth eol dma ndi dno tge thi ssu nha t

9. Here is what this might look like in terms of bases. Notice the amino acids on the top are different than the ones on the bottom, just by moving over one letter. This nonsense can happen from an insertion of an extra base or deletion of a base and are known as frame-shift mutations.

10. Aren’t There Any Good Yes, there are! On rare occasions, a mutation can make an organism more likely to survive and reproduce. Mutations?

11. For example, a species of plant might produce a chemical with a scent that attracts pollinating flies. A mutation in one of the plants could make it produce a slightly different scent—one that is even more attractive to pollinators. This type of mutation would be beneficial to the plant.

12. However, even if a mutation benefits an organism, it may not be passed on to the organism’s offspring. For organisms that reproduce sexually, mutations can be passed to the next generation only if they occur in the organism’s sex cells (eggs or sperm).

13. For one thing, not all mutations lead to a different protein being made. There are more codons than there are amino acids. If most mutations don’t have an effect on an organism. How can that happen?

14. If most mutations don’t have an effect on an organism. How can that happen? What would happen if the mRNA codon CUC were mutated to CUG? CGU were mutated to CGA? ACG were mutated to ACC? So, more than one codon can code for the same amino acid.