Human myeloproliferative neoplasms: molecular mechanisms, diagnosis and classification

1. Human myeloproliferative neoplasms: molecular mechanisms, diagnosis and classification Tony Green Cambridge Institute for Medical Research University of Cambridge and Addenbrookes Hospital

3. 5. Completion of last total selective sweep 6. Final rate-limiting driver mutation 3. Further driver mutations and clonal expansions 2. First driver mutation 4. Appearance of most recent common ancestor 1. Normal mammary epithelial development 7. Diagnosis Nik-Zainal et al Cell 2012

4. Myeloproliferative neoplasms Red cells Blood stem cell Progenitors Platelets • Arise in blood stem cell • Increased production of mature cells • Window on earliest stage of tumorigenesis • Tractable – accessible tissue, chronic diseases, clonal analysis

5. The BCR-ABL negative myeloproliferative neoplasms Polycythaemia Vera (PV) JAK2 V617F mutation 60% 95% Essential thrombocythaemia (ET) Acute myeloid leukaemia

6. Exon 12 V617F FERM SH2 JH2 Kinase The JAK2 V617F mutation neg JAK2 Exon 12 mutations Exon 16 mutations V617F mutation A T G T N T C T A T G T T T C T A T G T G T C T Grans T cells Homozygous Mitotic recombination James et al Nature 2005; Baxter et al Lancet 2005 Levine et al Cancer Cell 2005; Kralovics et al NEJM 2005 Scott et al NEJM 2007; Bercovich et al Lancet et al 2008

7. P P P P P P P P MAPK MAPK PI3K PI3K pSTAT5 pSTAT5 “It all starts to make sense” EPOR TPOR JAK2

8. Appearance of most recent common ancestor Diagnosis

9. Rapid direct clinical impact 2005 2010 Identification of JAK2 mutation PT-1 trials Specialist MPN clinic Recognition of new disease subtypes Molecular testing in regional diagnostic service Therapeutic JAK2 inhibitors Selected Green lab translational papers since 2005 Zhao et al NEJM 2008 Campbell et al JCO 2009 Beer et al Blood 2010 Chen et al Cancer Cell 2010 Godfrey et al Blood 2012 Harrison et al NEJM 2005 Baxter et al Lancet 2005 Campbell et al Lancet 2005 Scott et al Blood 2006 Campbell et al Blood 2006a Campbell and Green NEJM 2006 Campbell et al Blood 2006b Scott et al NEJM 2007 Wilkins et al Blood 2008 Beer et al Blood 2008

10. Old criteria for diagnosis of PV A 1 Red cell mass >25% above predicted or Hct >60% male, >56% female 2 No cause for 2o erythrocytosis 3 Palpable splenomegaly 4 Clonality marker B 1 Platelet count >400 x109/l 2 Neutrophils >10 x109/L (>12.5 in smokers) 3 Splenomegaly on imaging 4 Endogenous erythroid colonies or reduced serum epo A1 + A2 + any other A establishes diagnosis A1 + A2 + two of B establish diagnosis

11. Diagnostic criteria 20012 • Raised Hb 2 JAK2 mutation 3 No cause for 20 erythrocytosis - normal art O2 -serum epo not high McMullin et al BCSH guidelines BJH 2005, 2007

12. Idiopathic erythrocytosis or PV? erythroid colony granulocytes wt ATGGTGTTTCACAAAATCAGAAAT M V F H K I R N mut ATGGTGTTTCAATTAATCAGAAAT M V F Q LI R N Exon 12 V617F FERM SH2 JH2 Kinase Scott et al NEJM 2007

13. PV variant with JAK2 exon 12 mutations H&E Glycophorin A Isolated erythrocytosis Can be low level in blood granulocytes erythroid colony High Resolution Melt Analysis Multiple mutations Scott et al NEJM 2007; Percy et al Haematologica 2007; Boyd et al BJH 2010

14. Diagnosis of ET: JAK2 or MPL mutation-positive BCSH guidelines 2009 Sustained platelet count >450 Acquired mutation (JAK2 or MPL) No other myeloid malignancy WHO 2008 Sustained platelet count >450 Acquired mutation (JAK2 or MPL) No other myeloid malignancy Typical bone marrow appearances (reticulin ≤ grade 2) BUT in absence of mutation still need to exclude reactive causes

15. Distinguishing different MPNs ET PV PMF diagnose and Beer et al Blood 2011

16. Distinguishing different MPNs ET PV PMF diagnose and Beer et al Blood 2011

17. ET is heterogeneous Key issue – can Cologne/WHO histological criteria identify distinct disease entities

18. WHO book is like a country – with good aspects…

19. ….. but some aspects less good

20. ….. but some aspects less good

21. Three questions • Is prefibrotic PMF really distinct • Can WHO criteria be applied reproducibly • Is prefibrotic MF a useful concept

22. Distinguishing ET from PMF Role of histology “Prefibrotic PMF” “True ET” ET ? • 3 experienced haematopathologists, large prospective cohort (PT1 study) , blinded analysis of WHO diagnosis and 16 morphological criteria Campbell et al Lancet 2005 Scott et al Blood 2006 Wilkins et al Blood 2008 Campbell et al JCO 2009

23. Conclusions Even experienced haematopathologists don’t agree on what to call “true ET” & “prefibrotic PMF” Two alternative explanations: - ‘Prefibrotic PMF’ not a distinct entity - ‘Prefibrotic PMF’ exists but special training required - even if true, questionable utility of criteria the application of which is so difficult even for highly experienced pathologists

24. Utility of prefibrotic PMF criteria (WHO 2008) YES: Thiele et al Blood 2011 Barbui, Thiele et al JCO 2011 Concordance 73-88% NO: Brousseau et al Histopathology 2010 “Distinction between ET and prefibrotic PMF is of questionable clinical relevance” Buhr, Kreipe et al Haematologica 2012 > 50% no agreement or unclassifiable - “WHO criteria for discriminating ET from prefibrotic PMF are poorly to only moderately reproducible”

25. Barbui, Thiele et al JCO 2011 • Limitation of consensus approach to histology • MF progression at 15 yrs: 10% vs 17% true ET vs prefib MF • Leuk progression at 15 yrs 2% vs 11% - but no mention of therapy • Even if real difference – prefibrotic PMF likely to represent later stage of same disease process

26. Three questions ? later stage disease • Is prefibrotic PMF really distinct • Can WHO criteria be applied reproducibly • Is prefibrotic PMF a useful concept NO

27. Nomenclature of “prefibrotic PMF” is flawed Prefibrotic PMF? “True ET” PV PMF

28. Nomenclature of “prefibrotic PMF” is flawed Prefibrotic PMF? ET PV PMF

29. Nomenclature of “prefibrotic PMF” is flawed 5-30% ET PV PMF

30. Nomenclature of “prefibrotic PMF” is flawed Prepolycythaemic PV? ET PV PMF

31. Concept of “prefibrotic PMF” is also potentially dangerous For individual patient management - inappropriate therapy (eg BMT) for low risk patients For the MPN field - patient cohorts will not be comparable

32. Three questions ? later stage disease • Is prefibrotic PMF really distinct • Can WHO criteria be applied reproducibly • Is prefibrotic PMF a useful concept NO Flawed Dangerous

34. Distinguishing ET from PMF Thrombocytosis with isolated increased reticulin • Relatively common – 15-20% • Unclassifiable under WHO • Benign prognosis Implications – patient predisposed to robust fibrosis but lacks 2nd hits needed for evolution of clinical disease

35. Distinguishing ET from PMFPMF as presentation in accelerated phase of pre-existing MPN • PMF and MF transformation indistinguishable • PMF patients may have prior thrombocytosis • PMF exhibits features of late stage disease - high clonal burden – more cytogenetic abnormalities - increased progression to AML

36. Molecular classification of ET and PMF Mutation load Accel phase Includes MF transformn + some PMF and atypical CML retic dysplasia WBC Leuk phase Chronic phase Heterogeneous (mostly Pl) JAK2 MPL Campbell and Green NEJM 2006 Beer et al Blood 2011

37. Distinguishing different MPNs ET PV PMF diagnose and Beer et al Blood 2011

38. Distinguishing ET from PV JAK2 mut neg JAK2 mut pos Higher Hb and WBC Increased e’poiesis and g’poiesis More venous thrombosis More transformation to PV 809 ET patients in PT-1 trial JAK2-positive ET is forme fruste of PV Campbell et al Lancet 2005 Scott et al Blood 2006 Harrison et al NEJM 2005 Campbell et al Lancet 2005

39. Suppression of Epo in JAK2-pos ET 40 JAK2 WT 35 JAK2 V617F 30 25 Serum Epo (mU/mL) 20 p<0.0001 15 10 5 0 11 12 13 14 15 16 Haemoglobin (g/dL)

40. Distinguishing ET from PV PV Normal ET N 14 16 18 20 Hb Inherent problem in using continuous variable (eg Hct or RCM) to make a binary distinction

41. Rare Common Mitotic recombination One mutation but two diseases Essential thrombocythaemia Polycythaemia vera Hypothesis – homozygosity for JAK2 mutation causes PV phenotype

42. JAK2V617F knockin mouse – homozygosity causes phenotypic switch from ET to PV Haematocrit Platelets Haematocrit (%) Platelets (x103)/µl WT Het Hom WT Het Hom Li et al Blood 2010 Juan Li, David Kent unpublished

43. ET Heterozygous JAK2V617F 9p LOH PV

44. Homozygous mutant BFU-E present in many patients with ET PV 80% ET 52% Higher number of homozygous colonies in PV patients compared to ET - homozygous clone has selective advantage in PV but not ET - recurrent acquisition of homozygosity Godfrey et al Blood 2012

45. 4.0 D9S288 4.8 D9S1810 6.2 D9S1852 14.8 D9S235 18.3 D9S925 19.7 D9S162 27.6 D9S161 30.9 D9S43 33.9 D9S1817 36.4 D9S1791 38.3 D9S2148 102.1 D9S176 Recurrent acquisition of 9p LOH in patient with PV A B C Heterozygous LOH Tel Mb from telomere JAK2 A B C 170 180 170 180 170 180 125 130 135 125 130 135 125 130 135 Cen Number of colonies 44 5 4

46. Summary • Recurrent acquisition of homozygosity - in 5/8 PV patients and 2/2 ET patients tested - resolution limited (2.3 to 14.2 Mb) so number of distinct clones may be underestimate • PV distinguished from ET by presence of dominant homozygous clone ~10 fold larger than minor clones - ? additional lesions • Multiple clones arise in HSPC compartment - persist over time - detectable in sorted CMPs

47. ET Heterozygous JAK2V617F Recurrent 9p LOH PV

48. IFNG up-regulated genes NES: -2.156 q val: <0.002 PV ET WT MUT pSTAT1 Differential STAT1 signaling in heterozygous colonies from patients with ET and PV Arrays Pathway Key regulator DAPI pSTAT1 Actin ET PV Chen et al Cancer Cell 2010

49. Essential thrombocythaemia Polycythaemia vera JAK2 V617F JAK2 V617F STAT1 defect JAK2 homozyg Clonal expansion

50. Conclusions and questions • Unexpected complexity in early phase of “simple” malignancy • Questions - how does clone expand given HSC defect - what drives recurrent mitotic recombination - what drives expansion of dominant homozygous clone in PV - cause and effects of pSTAT1 defect in heterozygous PV cells • Exomes coming