1 / 61

Pair-wise Sequence Alignment - PowerPoint PPT Presentation

  • Uploaded on

C. E. N. T. E. R. F. O. R. I. N. T. E. G. R. A. T. I. V. E. B. I. O. I. N. F. O. R. M. A. T. I. C. S. V. U. Introduction to bioinformatics 2007 Lecture 5. Pair-wise Sequence Alignment. Bioinformatics.

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
Download Presentation

PowerPoint Slideshow about ' Pair-wise Sequence Alignment' - artan

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript





































Introduction to bioinformatics 2007

Lecture 5

Pair-wise Sequence Alignment


  • “Nothing in Biology makes sense except in the light of evolution” (Theodosius Dobzhansky (1900-1975))

  • “Nothing in bioinformatics makes sense except in the light of Biology”

A protein sequence alignment



* * * **** ***

A DNA sequence alignment



*** **** **** ** ******

Searching for similarities

What is the function of the new gene?

The “lazy” investigation (i.e., no biologial experiments, just bioinformatics techniques):

– Find a set of similar protein sequences to the unknown sequence

– Identify similarities and differences

– For long proteins: first identify domains

  • Evolutionary and functional relationships

  • Reconstruct evolutionary relation:

  • Based on sequence

    • -Identity (simplest method)

    • -Similarity

  • Homology (common ancestry: the ultimate goal)

  • Other (e.g., 3D structure)

  • Functional relation:

  • SequenceStructureFunction

Searching for similarities

Common ancestry is moreinteresting:

Makes it more likely that genes share

the same function

Homology: sharing a commonancestor

– a binary property (yes/no)

– it’s a nice tool:

When (anunknown) gene X ishomologous to (a known) gene G itmeans that we gain a lot of informationon X: what we know about G can be transferred to X as a good suggestion.

How to go from dna to protein sequence
How to go from DNA to protein sequence

A piece of double stranded DNA:

5’attcgttggcaaatcgcccctatccggc 3’

3’ taagcaaccgtttagcggggataggccg 5’

DNA direction is from 5’ to 3’

How to go from dna to protein sequence1
How to go from DNA to protein sequence

6-frame translation using the codon table (last lecture):

5’attcgttggcaaatcgcccctatccggc 3’

3’ taagcaaccgtttagcggggataggccg 5’

Bioinformatics tool







Example today: Pairwise sequence alignment needs sense of evolution

Global dynamic programming














Amino Acid Exchange


Search matrix


Gap penalties (open,extension)





How to determine similarity?

  • Frequent evolutionary events:1. Substitution2. Insertion, deletion3. Duplication4. Inversion

  • Evolution at work

We’ll only use these

Common ancestor, usually extinct




Alignment - the problem


||||||| algorithms4genomes




||||||||||? |||||||algorithms4--genomes

  • Operations:

    • substitution,

    • Insertion

    • deletion

A protein sequence alignment



* * * **** ***

A DNA sequence alignment



*** **** **** ** ******

Dynamic programmingScoring alignments

– Substitution (or match/mismatch)


• proteins

– Gap penalty

• Linear: gp(k)=ak

• Affine: gp(k)=b+ak

• Concave, e.g.: gp(k)=log(k)

The score for an alignment is the sum of the scores of all alignment columns

Dynamic programmingScoring alignments

– Substitution (or match/mismatch)


• proteins

– Gap penalty

• Linear: gp(k)=ak

• Affine: gp(k)=b+ak

• Concave, e.g.: gp(k)=log(k)

The score for an alignment is the sum

of the scores over all alignment columns






  • /

Gap length

General alignment score:


Substitution Matrices: DNA

define a score for match/mismatch ofletters


Used in genome alignments:

Substitution matrices for a.a.

  • Amino acids are not equal:

    • Some aresimilar and easily substituted:

      • biochemical properties

      • structure

    • Some mutations occur more often due to similar codons

  • The two above give us substitution matrices

orange: nonpolar and hydrophobic.

green: polar and hydrophilic

magenta box are acidic

light blue box are basic

BLOSUM 62 substitution matrix











Constant vs. affine gap scoring

…and +1 for match

Seq1 G T A - - G - T - ASeq2 - - A T G - A T G -

Const -2 –2 1 –2 –2 (SUM = -7) -2 –2 1 -2 –2 (SUM = -7)

Affine –4 1 -4 (SUM = -7) -3 –3 1 -3 –3 (SUM = -11)‏

Dynamic programmingScoring alignments


T D W L - - I K




Affine gap penalties (open, extension)

Amino Acid Exchange Matrix

Score: s(T,T)+s(D,D)+s(W,W)+s(V,L)-Po-2Px +


Amino acid exchange matrices


How do we get one?

And how do we get associated gap penalties?

First systematic method to derive a.a. exchange matrices by Margaret Dayhoff et al. (1968) – Atlas of Protein Structure

A 2

R -2 6

N 0 0 2

D 0 -1 2 4

C -2 -4 -4 -5 12

Q 0 1 1 2 -5 4

E 0 -1 1 3 -5 2 4

G 1 -3 0 1 -3 -1 0 5

H -1 2 2 1 -3 3 1 -2 6

I -1 -2 -2 -2 -2 -2 -2 -3 -2 5

L -2 -3 -3 -4 -6 -2 -3 -4 -2 2 6

K -1 3 1 0 -5 1 0 -2 0 -2 -3 5

M -1 0 -2 -3 -5 -1 -2 -3 -2 2 4 0 6

F -4 -4 -4 -6 -4 -5 -5 -5 -2 1 2 -5 0 9

P 1 0 -1 -1 -3 0 -1 -1 0 -2 -3 -1 -2 -5 6

S 1 0 1 0 0 -1 0 1 -1 -1 -3 0 -2 -3 1 2

T 1 -1 0 0 -2 -1 0 0 -1 0 -2 0 -1 -3 0 1 3

W -6 2 -4 -7 -8 -5 -7 -7 -3 -5 -2 -3 -4 0 -6 -2 -5 17

Y -3 -4 -2 -4 0 -4 -4 -5 0 -1 -1 -4 -2 7 -5 -3 -3 0 10

V 0 -2 -2 -2 -2 -2 -2 -1 -2 4 2 -2 2 -1 -1 -1 0 -6 -2 4


PAM250 matrix

amino acid exchange matrix (log odds)

Positive exchange values denote mutations that are more likely than randomly expected, while negative numbers correspond to avoided mutations compared to the randomly expected situation

Amino acid exchange matrices

Amino acids are not equal:

1. Some are easily substituted because they have similar:

• physico-chemical properties

• structure

2. Some mutations between amino acids occur more often due tosimilar codons

The two above observations give us ways to define substitutionmatrices

Pair-wise alignment


T D W L - - I K

Combinatorial explosion

- 1 gap in 1 sequence: n+1 possibilities

- 2 gaps in 1 sequence: (n+1)n

- 3 gaps in 1 sequence: (n+1)n(n-1), etc.

2n (2n)! 22n

= ~

n (n!)2 n

2 sequences of 300 a.a.: ~1088 alignments

2 sequences of 1000 a.a.: ~10600 alignments!

Technique to overcome the combinatorial explosion dynamic programming
Technique to overcome the combinatorial explosion:Dynamic Programming

  • Alignment is simulated as Markov process, all sequence positions are seen as independent

  • Chances of sequence events are independent

    • Therefore, probabilities per aligned position need to be multiplied

    • Amino acid matrices contain so-called log-odds values (log10 of the probabilities), so probabilities can be summed

To say the same more statistically…

  • To perform statistical analyses on messages or sequences, we need a reference model.

  • The model: each letter in a sequence is selected from a defined alphabet in an independent and identically distributed (i.i.d.) manner.

  • This choice of model system will allow us to compute the statistical significance of certain characteristics of a sequence, its subsequences, or an alignment.

  • Given a probability distribution, Pi, for the letters in ai.i.d. message, the probability of seeing a particular sequence of letters i, j, k, ... n is simply Pi Pj Pk···Pn.

  • As an alternative to multiplication of the probabilities, we could sum their logarithms and exponentiate the result. The probability of the same sequence of letters can be computed by exponentiating log Pi + log Pj + log Pk+ ··· + log Pn.

  • In practice, when aligning sequences we only add log-odds values (residue exchange matrix) but we do not exponentiate the final score.

Sequence alignmentHistory of Dynamic Programming algorithm

  • 1970Needleman-Wunsch global pair-wise alignment

  • Needleman SB, Wunsch CD (1970) A general method applicable to the search for similarities in the amino acid sequence of two proteins,J Mol Biol. 48(3):443-53.

  • 1981Smith-Waterman local pair-wise alignment

    • Smith, TF, Waterman, MS (1981) Identification of common molecular subsequences. J. Mol. Biol. 147, 195-197.

Pairwise sequence alignment

Global dynamic programming














Amino Acid Exchange


Search matrix

Gap penalties (open,extension)



Global dynamic programming




Value from residue exchange matrix

H(i-1,j-1)+ S(i,j)

H(i-1,j) - g

H(i,j-1) - g




H(i,j) = Max

This is a recursive formula

Global alignment the needleman wunsch algorithm
Global alignmentThe Needleman-Wunsch algorithm

  • Goal: find the maximal scoring alignment

  • Scores: m match, -s mismatch, -g for insertion/deletion

  • Dynamic programming

    • Solve smaller subproblem(s)‏

    • Iteratively extend the solution

  • The best alignment for X[1…i] and Y[1…j]is called M[i, j]

X1 … Xi-1 -- Xi

Y1 … - Yj-1 Yj -

The algorithm


X[1…i] -

X[1…i-1] X[i]



Y[1…j] -

+ m

M[i-1, j-1]

- s

The algorithm

M[i,j] =

M[i, j-1] - g

M[i-1, j] - g

The algorithm final equation
The algorithm – final equation

Corresponds to:


X1…Xi-1 XiY1…Yj-1 Yj

M[i-1, j-1] + score(X[i],Y[j])‏

M[i, j] =


M[i, j-1] – g

X1…Xi -Y1…Yj-1 Yj

M[i-1, j] – g

X1…Xi-1 XiY1…Yj -








Example global alignment of two sequences
Example: global alignment of two sequences

  • Align two DNA sequences:

    • GAGTGA

    • GAGGCGA (note the length difference)‏

  • Parameters of the algorithm:

    • Match:score(A,A) = 1

    • Mismatch:score(A,T) = -1

    • Gap:g = -2

M[i-1, j-1] ± 1

M[i, j] =


M[i, j-1] – 2

M[i-1, j] – 2

The algorithm step 1 init


































The algorithm. Step 1: init

M[i-1, j-1] ± 1

M[i, j] =


M[i, j-1] – 2

  • Create the matrix

  • Initiation

    • 0 at [0,0]

    • Apply the equation…

M[i-1, j] – 2

The algorithm step 1 init1






























The algorithm. Step 1: init

M[i-1, j-1] ± 1

M[i, j] =


M[i, j-1] – 2

  • Initiation of the matrix:

    • 0 at pos [0,0]

    • Fill in the first row using the “” rule

    • Fill in the first column using “”

M[i-1, j] – 2



The algorithm step 2 fill in



































The algorithm. Step 2: fill in

M[i-1, j-1] ± 1

M[i, j] =


M[i, j-1] – 2

  • Continue filling in of the matrix, remembering from which cell the result comes (arrows)‏

M[i-1, j] – 2



The algorithm step 2 fill in1








































































The algorithm. Step 2: fill in

M[i-1, j-1] ± 1

M[i, j] =


M[i, j-1] – 2

  • We are done…

  • Where’s the result?

M[i-1, j] – 2


The lowest-rightmost cell


The algorithm step 3 trace back








































































The algorithm. Step 3:traceback

M[i-1, j-1] ± 1

M[i, j] =


M[i, j-1] – 2

  • Start at the last cell of the matrix

  • Go against the direction of arrows

  • Sometimes the value may be obtained from more than one cell (which one?)‏

M[i-1, j] – 2



The algorithm step 3 trace back1








































































The algorithm. Step 3: traceback

The ‘low’ and the ‘high’ road

  • Extract the alignments











You can also jump from the high to the low road in the middle (following the arrow): to what alignment does that lead?

Affine gaps

X1…Xi -Y1…Yj-1 Yj

Affine gaps

  • Penalties:

    go - gap opening (e.g. -8)‏

    ge - gap extension (e.g. -1)‏

M[i-1, j-1]


M[i, j] =


score(X[i], Y[j]) +

Ix[i-1, j-1]

Iy[i-1, j-1]

M[i, j-1] + go

X1…-Y1… Yj

Ix[i, j] =


Ix[i, j-1] + ge

X1… - -Y1…Yj-1 Yj

M[i-1, j] + go

Iy[i, j] =


Iy[i-1, j] + gx

  • @ home: think of boundary values M[*,0], I[*,0] etc.

Semi global pairwise alignment
Semi-global pairwise alignment

  • Global alignment: all gaps are penalised

  • Semi-global alignment: N- and C-terminal (5’ and 3’) gaps (end-gaps) are not penalised





Variation on global alignment
Variation on global alignment

  • Global alignment: previous algorithms is called globalalignment, because it uses all letters from both sequences.CAGCACTTGGATTCTCGG CAGC-----G-T----GG

  • Semi-globalalignment: don’t penalize for end gaps


    • Applications of semi-global:

      • Finding a gene in genome

      • Placing marker onto a chromosome

      • One sequence much longer than the other

  • Danger! – really bad alignments for divergent seqs

seq X:

seq Y:

Semi global pairwise alignment1
Semi-global pairwise alignment

Applications of semi-global:

– Finding a gene in genome

– Placing marker onto a chromosome

– One sequence much longer than the other

Danger: if gap penalties high -- really bad alignments for divergent sequences

Protein sequences have N- and C-terminal amino acids that are often small and hydrophilic

Semi global alignment



































Semi-global alignment

  • Ignore 5’ or N-terminal end gaps

    • First row/column set to 0

  • Ignore C-terminal or 3’ end gaps

    • Read the result from last row/column

Take-home messages

  • Homology

  • Why are we interested in similarity?

  • Pairwise alignment: global alignment and semi-global alignment

  • Three types of gap penalty regimes: linear, affine and concave

  • Make sure you can calculate alignment using the DP algorithm

  • a heuristic

    • Heuristics: A rule of thumb that often helps in solving a certain class of problems, but makes no guarantees.Perkins, DN (1981) The Mind's Best Work

Global dynamic programmingPAM250, Gap=6 (linear)

These values are copied from the PAM250 matrix (see earlier slide)

The extra bottom row and rightmost column give the penalties that would need to be applied due to end gaps

Higgs & Attwood, p. 124

Global dynamic programmingLinear, Affine or Concave gap penalties


All penalty schemes are possible because the exact length of the gap is known


Gap opening penalty

Max{S0<x<i-1, j-1- Pi - (i-x-1)Px}


Max{Si-1, 0<y<j-1 - Pi - (j-y-1)Px}

Si,j = si,j + Max

Gap extension penalty

Global dynamic programming gap o 10 gap e 2
Global dynamic programmingGapo=10, Gape=2

These values are copied from the PAM250 matrix (see earlier slide), after being made non-negative by adding 8 to each PAM250 matrix cell (-8 is the lowest number in the PAM250 matrix)

The extra bottom row and rightmost column give the final global alignment scores

Easy dp recipe for using affine gap penalties
Easy DP recipe for using affine gap penalties


  • M[i,j] is optimal alignment (highest scoring alignment until [i,j])

  • Check

    • preceding row until j-2: apply appropriate gap penalties

    • preceding row until i-2: apply appropriate gap penalties

    • and cell[i-1, j-1]: apply score for cell[i-1, j-1]


Dp is a two step process
DP is a two-step process

  • Forward step: calculate scores

  • Trace back: start at highest score and reconstruct the path leading to the highest score

    • These two steps lead to the highest scoring alignment (the optimal alignment)

    • This is guaranteed when you use DP!

Semi-global dynamic programming- two examples with different gap penalties -

These values are copied from the PAM250 matrix (see earlier slide), after being made non-negative by adding 8 to each PAM250 matrix cell (-8 is the lowest number in the PAM250 matrix)

Global score is 65 –10 – 1*2 –10 – 2*2

Local dynamic programming(Smith & Waterman, 1981)














Amino Acid

Exchange Matrix

Search matrix

Gap penalties

(open, extension)



Local dynamic programming(Smith & Waterman, 1981)



Gap opening penalty

Si,j + Max{S0<x<i-1,j-1 - Pi - (i-x-1)Px}

Si,j + Si-1,j-1

Si,j + Max {Si-1,0<y<j-1 - Pi - (j-y-1)Px}


Si,j = Max

Gap extension penalty

Dot plots
Dot plots

  • Way of representing (visualising) sequence similarity without doing dynamic programming (DP)

  • Make same matrix, but locally represent sequence similarity by averaging using a window

Comparing two sequences

We want to be able to choose the best alignment between two sequences.

A simple method of visualising similarities between two sequences is to use dot plots. The first sequence to be compared is assigned to the horizontal axis and the second is assigned to the vertical axis.

Dot plots can be filtered by window approaches (to calculate running averages) and applying a threshold

They can identify insertions, deletions, inversions
