1 / 51

Familial Cancer Syndromes

Familial Cancer Syndromes. the familial occurrence of cancer clinical oncogenetics hereditary breast- en ovarian cancer hereditary colorectal cancer. Causes of cancer. Causes of cancer: environmental hereditary Hereditary factors: evidence positive family history twin studies

armen
Download Presentation

Familial Cancer Syndromes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Familial Cancer Syndromes • the familial occurrence of cancer • clinical oncogenetics • hereditary breast- en ovarian cancer • hereditary colorectal cancer

  2. Causes of cancer Causes of cancer: environmental hereditary Hereditary factors: evidence positive family history twin studies occurrence cancer in certain ethnic groups

  3. History for breast cancer

  4. The familial occurrence of cancer 8 Relative risk 3 population risk 1 Cumulative risk ~12% to 30% to 90% hereditary 5% sporadic ~80% familial 15% Contribution of environmental factors Contribution of genetic factors

  5. Determinants • General • ‘closeness’ of relatives • age at diagnosis • ratio affected to ‘at risk’ • Breast cancer: • 1 or > first degree relatives • young age (<50 years) • bilateral breast cancer or ovarian cancer • breast cancer in males

  6. BrCa 50j BrCa 53j Hereditary vs. familial: breast cancer hereditary breast- and ovarian cancer familial breast cancer OvCa 40j BrCa 38j Bil BrCa 41&47j BrCa 39j A priori risk: highly increased A priori risk: moderately increased

  7. Genetic contribution to cancer General: twin studies: concordant vs. discordant contribution: limited important in: colorectal cancer breast cancer prostate cancer

  8. Family cancer syndromes Definition: Clinical syndrome characterized by the preferential occurrence of certain tumors in a family often: specific tumors sometimes: associated clinical signs

  9. Inheritance All family cancer syndromes: segregation and therefore monogenic all known: autosomal inheritance most: dominant some: recessive most: genetic heterogeneity variable penetrance

  10. Autosomal dominant inheritance +/+ -/+ -/+ :carrier +/+ :wild type -/+ +/+ -/+ +/+ -/+ +/+ 1 of the parents: affected risk: 50% independent of gender affected relatives in all generations

  11. Autosomal recessive inheritance +/+ -/+ -/- :affected -/+ :carrier, unaffected -/+ -/+ +/+ :wild type +/+ -/+ -/+ -/- generally no affected parents risk: 25% independent of gender no affected relatives

  12. hyperplasia metaplasia dysplasia CIS Additional genetic aberrations The Knudson hypothesis family cancer syndromes Sporadic tumors

  13. - - + gametogenesis gametogenesis + - + - Knudson and dominant inheritance

  14. Family cancer syndromes Autosomal dominant Adenomatous polyposis APC Hereditary Non-Polyposis Colorectal Cancer (HNPCC) MLH1, MSH2, MSH6 Hereditary Breast- and Ovarian Cancer (HBOC) BRCA1, BRCA2 Li-Fraumeni TP53, CHK2 Neurofibromatosis NF1, NF2 Retinoblastoma RB Von Hippel Lindau VHL Wilms’ tumors WT1, 2 & 3 Autosomal recessive Ataxia teleangiectasia ATM Bloom syndrome BLM Werner’s syndrome WRN Fanconi’s anemia FACC Xeroderma pigmentosum XPA-E, ERCC2-5

  15. Tumor suppressor genes Gatekeepers: direct inhibitors van cell growth e.g.: APC Landscapers: modulate the micro-environment e.g.: NF1 Caretakers: DNA repair genes e.g.: mismatch repair genes MLH1, MSH2, MSH6

  16. indication for molecular genetic testing • genetic counseling • follow-up • risk in unaffected relatives Clues to an inherited predisposition to cancer young age at diagnosis aggregation of rare tumors association with congenital malformations multiple primary tumors in an individual bilateral tumors in paired organs positive family history tumor types inheritance pattern clinical aberrations clinical diagnosis

  17. Genetic counseling 1st counseling: intake mutation analysis no indication for mutation analysis 2nd counseling:communication of test results no mutation BRCA1 or BRCA2 mutation empirical risk estimation follow-up & preventive measures presymptomatic testing

  18. Informed consent • Issues: • the right not to be tested • purpose of genetic testing • reliability of genetic testing • course of genetic testing • cost of genetic testing • implications of both positive and negative test results • the possibility that no additional risk information will be obtained at the completion of the test • the options for approximation of risk without genetic testing • disadvantages of genetic testing • confidentiality of the test results • possibility of discrimination • preventive measures - limited proof of efficacy • risk for carriership in children

  19. Mutation analysis • Techniques: • PTT (protein truncation test) • DGGE (denaturing gradient gel electrophoresis) • Southern blot • PCR cDNA and gDNA • direct sequencing • Detetection ratio: • dependent of mutational spectrum • dependent of the used techniques • dependent of the a priori chance of finding a mutation in a family member

  20. normal length (51 kDa) normal length (62 kDa) truncated peptide (30 kDa) truncated peptide (22 kDa) Molecular genetics testing: PTT Forward primer GGATCC TAATACGACTCATATAGGAACAGACCAGCATGG translation initiation signal Bacteriophage T7 promotor PCR T7 Technique of choice for the detection of nonsense mutations e.g.: BRCA1&2 exon 11 in vitro transcription/ translation T7 polymerase lysate Rnase inhibitor amino acids without leucine H³ leucine RNA AUG peptide SDS - PAGE autoradiography

  21. Molecular genetic testing: DGGE Wild type DNA ( allel A) Mutant DNA ( allel B) G A GC- clamp GC- clamp C T analogous to: SSCP Heteroduplex analysis denaturation G A C T • technique of choice for: • substitutions • small deletions and insertions re-annealing homoduplex DNA heteroduplex DNA G G allele AA allele AB C T C A allele BB allele BA T A AA BB AB low concentration UF HETERODUPLEXES HOMODUPLEXES high concentration UF

  22. Presymptomatic testing Definition genetic testing for a known mutation in an unaffected ‘at risk’ relative - + + + + - + + + + + BRCA1 Q1281X

  23. Hereditary breast- and ovarian cancer • Clinical description: • Breast and/or ovarian cancer: • in at least 3 first degree relatives or 3 second degree relatives (in case of paternal transmission) • in at least two successive generations • in at least one patient: Dx <50 years of age • Inheritance: autosomal dominant • Genes: • BRCA1 & BRCA2 (~80%)

  24. Epidemiology 85% 15% ~40% ~60%

  25. BRCA1 BRCA2 Molecular genetics both genes: ~800 different mutations no ‘hotspots’, strong ‘founder effects’ mutations: spread over coding sequence as well as in non coding parts wide array of different types

  26. Founder mutation Mutation that is particularly frequent in a certain population due to a common ancestor characteristic: markers surrounding the mutation are in‘linkage disequilibrium’ Linkage disequilibrium: A condition where two genes are found together in a population at a greater frequency than that predicted simply by the product of their individual gene frequencies.

  27. Founder mutation ‘old’ ‘recent’

  28. Consensus splice donor sequence A G C A GT AGT AG exon intron Wild type BRCA1 exon 5 splice donor AAG GTATAT exon 5 intron 5 22 0,91 Founder mutation BRCA1 IVS5+3A>G ‘Consensus value’ 0,92 BRCA1 IVS5+3A>G exon 5 splice donor TATGTAAGA---- AAG GTGTAT 0,53

  29. DGGE Exon 5 Intron 5 Sequencing Founder mutation BRCA1 IVS5+3A>G

  30. BRCA1 & BRCA2: molecular profiling

  31. Follow-up • Counseling • non-directive • conjointly with referring physician • Interventions • intensive screening • prophylactic surgery • chemoprophylaxis • Evidence • limited proof of efficacy • few prospective studies

  32. Example - + + + + BrCa 53j Bil. BrCa 36&46j BrCa 51j phenocopy - + + + + + BRCA1 Q1281X BrCa 29j

  33. Familial breast cancer: conclusions • Hereditary breast- and ovarian cancer: • Major contribution of BRCA1 & BRCA2 • Genetic testing: useful • Small group of patients with highly increased risk • Familial breast cancer: • Minor contribution of BRCA1 & BRCA2 • Genetic testing: limited use • Large group of patients with moderately increased risk • Probably: genetic variants, ‘modifier genes’, multifactorial inheritance

  34. Familial prediposition to colorectal cancer Hereditary colorectal cancer HNPCC: hereditary non-polyposis colorectal carcinoma FAP: familial adenomatous polyposis Familial colorectal cancer Preferential occurrence of colorectal cancer in a family without evidence for a heritable cancer syndrome

  35. Familial Polyposis Adenomatous Definition: familial colorectal cancer syndrome characterized by the predisposition to develop 100 to 1000 polyps

  36. Familial Adenomatous Polyposis

  37. Molecular Genetic Testing FAP: autosomal dominant inheritance mutations in the APC gene complete coding sequence mutation analysis ~90% mutations: nonsense mutations PTT on cDNA APC mutations in ~80% of the FAP families

  38. Adenoma/carcinoma sequence

  39. APC: genotype/phenotype correlations 3’ 5’ NH2 COOH CHRPE + Classical FAP Attenuated FAP Attenuated FAP Desmoïd tumors ca. 100% Hereditary desmoid disease Desmoïd tumors 10-20 %

  40. Follow-up As soon as polyps are detected: prophylactic colectomy

  41. HNPCC Definition: familial cancer syndrome characterized by a highly increased risk for colorectal (~80%) and endometrial cancer (~60%) • Clinical description (Amsterdam I criteria): • Colorectal cancer: • in at least 3 relatives, one of which is a first degree relative of the other two • age at diagnosis in at least one patient <50 years • in at least two successive generations • FAP is excluded

  42. Molecular genetics • genes: • hMLH1 • hMSH2 • hMSH6 • complete coding sequence • mutation-analyse : • DGGE • Southern Blot • Additionally MSI en immunohistochemistry

  43. Microsatellite instability Mismatch repair Microsatellites Short stretches of repititive sequences mono-, di- and trinucleotide repeats ‘slippage’ of DNA polymerase

  44. Microsatellite instability Other tissues: normal mismatch repair Tumor: defective mismatch repair

  45. Microsatellite instability instability microsatellite D2S123 instability microsatellite BAT25 B B T T

  46. Microsatellite instability

  47. Microsatellite instability High MSI: prognostically favorable, even in sporadic colorectal carcinomas

  48. Immunohistochemistry 2 hit model: absent expression of the mutant tumor suppressor in the tumor normal MSI-H MSS

  49. Tumor characteristics • predeliction for the proximal colon; • undifferentiated growth pattern (solid or cribriform) • strong lymphocyte aggregation around the tumor colon transversum colon descendens colon ascendens

  50. MIN en CIN: gatekeepers and caretakers • MIN: microsatellite instability • mutation in caretakers • euploid • proximal colon (colon ascendens) • slow initiation, fast progression • CIN: chromosomal instability • mutation in gatekeeper • aneuploid • distal • fast initiation, slow progression • (NER: nucleotide excision repair)

More Related